Algorithm details
Adapter alignment algorithm
Since the publication of the EMBnet journal application note about Cutadapt, the alignment algorithm used for finding adapters has changed significantly. An overview of this new algorithm is given in this section. An even more detailed description is available in Chapter 2 of my PhD thesis Algorithms and tools for the analysis of high-throughput DNA sequencing data.
The algorithm is based on semiglobal alignment, also called free-shift, ends-free or overlap alignment. In a regular (global) alignment, the two sequences are compared from end to end and all differences occuring over that length are counted. In semiglobal alignment, the sequences are allowed to freely shift relative to each other and differences are only penalized in the overlapping region between them:
FANTASTIC
ELEFANT
The prefix ELE
and the suffix ASTIC
do not have a counterpart in the
respective other row, but this is not counted as an error. The overlap FANT
has a length of four characters.
Traditionally, alignment scores are used to find an optimal overlap aligment: This means that the scoring function assigns a positive value to matches, while mismatches, insertions and deletions get negative values. The optimal alignment is then the one that has the maximal total score. Usage of scores has the disadvantage that they are not at all intuitive: What does a total score of x mean? Is that good or bad? How should a threshold be chosen in order to avoid finding alignments with too many errors?
For Cutadapt, the adapter alignment algorithm primarily uses unit costs instead. This means that mismatches, insertions and deletions are counted as one error, which is easier to understand and allows to specify a single parameter for the algorithm (the maximum error rate) in order to describe how many errors are acceptable.
There is a problem with this: When using costs instead of scores, we would like to minimize the total costs in order to find an optimal alignment. But then the best alignment would always be the one in which the two sequences do not overlap at all! This would be correct, but meaningless for the purpose of finding an adapter sequence.
The optimization criteria are therefore a bit different. The basic idea is to consider the alignment optimal that maximizes the overlap between the two sequences, as long as the allowed error rate is not exceeded.
Conceptually, the procedure is as follows:
Consider all possible overlaps between the two sequences and compute an alignment for each, minimizing the total number of errors in each one.
Keep only those alignments that do not exceed the specified maximum error rate.
Then, keep only those alignments that have a maximal number of matches (that is, there is no alignment with more matches). (Note: This has been changed, see the section below for an update.)
If there are multiple alignments with the same number of matches, then keep only those that have the smallest error rate.
If there are still multiple candidates left, choose the alignment that starts at the leftmost position within the read.
In Step 1, the different adapter types are taken into account: Only those overlaps that are actually allowed by the adapter type are actually considered.
Alignment algorithm changes in Cutadapt 4
The above algorithm has been tweaked slightly in Cutadapt 4. The main problem was that the idea of maximizing the number of matches (criterion 3 in the section above) sometimes leads to unintuitive results.
For example, the previous algorithm would prefer an alignment such as this one:
CCAGTCCTTTCCTGAGAGT Read
|||||||| ||
CCAGTCCT---CT 5' adapter
This alignment was considered to be the best one because it contains 10 matches,
which is the maximum possible.
The three consecutive deletions are ignored when making that decision.
To the user, the unexpected result is visible because the read would end up as
GAGAGT
after trimming.
With the tuned algorithm, the alignment is more sensible:
CCAGTCCTTTCCTGAGAGT Read
||||||||X|
CCAGTCCTCT 5' adapter
The trimmed read is now CCTGAGAGT
, which is what one would likely expect.
The alignment algorithm in Cutadapt can perhaps now be described as a hybrid algorithm that uses both edit distance and score:
Edit distance is used to fill out the dynamic programming matrix. Conceptually, this can be seen as computing the edit distance for all possible overlaps between the read and the adapter. We need to use the edit distance as optimization criterion at this stage because we want to be able to let the user provide a maximum error rate (
-e
). Also, using edit distance (that is, unit costs) allows using some optimizations while filling in the matrix (Ukkonen’s trick).A second matrix with scores is filled in simultaneously. The value in a cell is the score of the edit-distance-based alignment, the score is not used as optimization criterion.
Finally, the score is used to decide which of the overlaps between read and adapter is the best one. (This means looking into the last row and column of the score matrix.)
The score function is currently: match: +1, mismatch: -1, indel: -2
A second change in the alignment algorithm is relevant if there are multiple adapter occurrences in a read (such as adapter dimers). With the new algorithm, leftmost (earlier) adapter occurrences are now more reliably preferred even if a later match has fewer errors.
Here are two examples from the SRR452441 dataset (R1 only), trimmed with the standard Illumina adapter. The top row shows the alignment as found by the previous algorithm, the middle row shows the sequencing read, and the last row shows the alignment as found by the updated algorithm.
@SRR452441.2151945
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Previous alignment
||||||||||||||||||||||||||||||||||
-GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAATCTCGTATGCCGTCTTCT
X|||||||||||||||||||||||||||||||||
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC New alignment
Previously the read was trimmed to the first 40 bases, now the earlier, nearly full-length occurrence is taken into account, and the read is empty after trimming.
@SRR452441.2157038
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Previous alignment
||||||||||||||||||||||||||||||||||
-GATCGGAAGAGCACACGTCTGAACTCCAGTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCACACGAATCTCGTATGCCGTCTTCTGCTTGAAAA
X||||||||||||||||||||||||||||||||X
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC New alignment
Only very few reads should be affected by the above changes (in SRR452441, which has 2.2 million reads, only four reads were trimmed differently). In those cases where it matters, however, there should now be fewer surprises.
Quality trimming algorithm
The trimming algorithm implemented in Cutadapt is the same as the one used by BWA, but applied to both ends of the read in turn (if requested). That is: Subtract the given cutoff from all qualities; compute partial sums from all indices to the end of the sequence; cut the sequence at the index at which the sum is minimal. If both ends are to be trimmed, repeat this for the other end.
The basic idea is to remove all bases starting from the end of the read whose quality is smaller than the given threshold. This is refined a bit by allowing some good-quality bases among the bad-quality ones. In the following example, we assume that the 3’ end is to be quality-trimmed.
Assume you use a threshold of 10 and have these quality values:
42, 40, 26, 27, 8, 7, 11, 4, 2, 3
Subtracting the threshold gives:
32, 30, 16, 17, -2, -3, 1, -6, -8, -7
Then sum up the numbers, starting from the end (partial sums). Stop early if the sum is greater than zero:
(70), (38), 8, -8, -25, -23, -20, -21, -15, -7
The numbers in parentheses are not computed (because 8 is greater than zero), but shown here for completeness. The position of the minimum (-25) is used as the trimming position. Therefore, the read is trimmed to the first four bases, which have quality values 42, 40, 26, 27.
Poly-A trimming algorithm
The aim of the --poly-A
trimming algorithm is to find a suffix of the read that contains a high
number of A
nucleotides.
Conceptually, we consider all possible suffixes of the read. For each suffix, we count how many
A
and non-A
nucleotides it contains. We then exclude all suffixes from consideration that
have more than 20% non-A
because we assume these are not actually poly-A tails.
For each remaining suffix, we compute a score: Non-A
nucleotides get -2 and
A
nucleotides get +1, which we add up to get the score for the suffix.
Finally, we choose the suffix that maximizes that score and remove it from the read.
Shorter suffixes win if there is a tie.
An implementation in Python (input string is s
):
n = len(s)
best_index = n
best_score = score = errors = 0
for i, nuc in reversed(list(enumerate(range(n)))):
if nuc == "A":
score += 1
else:
score -= 2
errors += 1
if score > best_score and errors <= 0.2 * (n - i):
best_index = i
best_score = score
s = s[:best_index]
Expected errors
The --max-expected-errors
(short version: --max-ee
) option discards a
read if its number of expected errors exceeds the specified threshold.
This emulates a filtering option originally implemented in USEARCH. The number of expected errors is computed from the quality scores as described in the USEARCH paper by Edgar et al. (2015), (Section 2.2). That is, it is the sum of the error probabilities.
The USEARCH manual page has a lot more background on expected errors and how to choose a threshold.
The --max-average-error-rate
(short version: --max-aer
) option works
similarly but divides the expected errors by the length of the read.
The resulting fraction is then used to filter the read. This is especially
helpful on reads that have highly varying read length, such as those coming
from nanopore sequencing.