User guide¶

Basic usage¶

To trim a 3’ adapter, the basic command-line for Cutadapt is:

cutadapt -a AACCGGTT -o output.fastq input.fastq

The sequence of the adapter is given with the -a option. You need to replace AACCGGTT with the correct adapter sequence. Reads are read from the input file input.fastq and are written to the output file output.fastq.

Compressed in- and output files are also supported:

cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz

Cutadapt searches for the adapter in all reads and removes it when it finds it. Unless you use a filtering option, all reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed to a length of zero are output. All of this can be changed with command-line options, explained further down.

Trimming of paired-end data is also supported.

Input and output file formats¶

The supported input and output file formats are FASTA and FASTQ, with optional compression.

The input file format is recognized from the file name extension. If the extension was not recognized or when Cutadapt reads from standard input, the contents are inspected instead.

The output file format is also recognized from the file name extension. If the extensions was not recognized or when Cutadapt writes to standard output, the same format as the input is used for the output.

When writing a FASTQ file, a second header (the text after the + on the third line of a record) that possibly exists in the input is removed. When writing a FASTA file, line breaks within the sequence are removed.

Compressed files¶

Cutadapt supports compressed input and output files. Whether an input file needs to be decompressed or an output file needs to be compressed is detected automatically by inspecting the file name: For example, if it ends in .gz, then gzip compression is assumed

cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz

All of Cutadapt’s options that expect a file name support this.

The supported compression formats are gzip (.gz), bzip2 (.bz2) and xz (.xz).

The default compression level for gzip output is 6. Use option -Z to change this to level 1. The files need more space, but it is faster and therefore a good choice for short-lived intermediate files.

If available, Cutadapt uses pigz to speed up writing and reading of gzipped files.

Standard input and output¶

If no output file is specified via the -o option, then the output is sent to the standard output stream. Example:

cutadapt -a AACCGGTT input.fastq > output.fastq

There is one difference in behavior if you use Cutadapt without -o: The report is sent to the standard error stream instead of standard output. You can redirect it to a file like this:

cutadapt -a AACCGGTT input.fastq > output.fastq 2> report.txt

Wherever Cutadapt expects a file name, you can also write a dash (-) in order to specify that standard input or output should be used. For example:

tail -n 4 input.fastq | cutadapt -a AACCGGTT - > output.fastq

The tail -n 4 prints out only the last four lines of input.fastq, which are then piped into Cutadapt. Thus, Cutadapt will work only on the last read in the input file.

In most cases, you should probably use - at most once for an input file and at most once for an output file, in order not to get mixed output.

For the same reason, you should not use - for non-interleaved paired-end data.

You cannot combine - and gzip compression since Cutadapt needs to know the file name of the output or input file. if you want to have a gzip-compressed output file, use -o with an explicit name.

One last “trick” is to use /dev/null as an output file name. This special file discards everything you send into it. If you only want to see the statistics output, for example, and do not care about the trimmed reads at all, you could use something like this:

cutadapt -a AACCGGTT -o /dev/null input.fastq

Multi-core support¶

Cutadapt supports parallel processing, that is, it can use multiple CPU cores. Multi-core is not enabled by default. To enable it, use the option -j N (or the spelled-out version --cores=N), where N is the number of cores to use.

To automatically detect the number of available cores, use -j 0 (or --cores=0). The detection takes into account resource restrictions that may be in place. For example, if running Cutadapt as a batch job on a cluster system, the actual number of cores assigned to the job will be used. (This works if the cluster systems uses the cpuset(1) mechanism to impose the resource limitation.)

Make also sure that you have pigz (parallel gzip) installed if you use multiple cores and write to a .gz output file. Otherwise, compression of the output will be done in a single thread and therefore be a bottleneck.

New in version 1.15.

New in version 1.18: --cores=0 for autodetection

New in version 2.5: Multicore works with --untrimmed/too-short/too-long-(paired)-output

New in version 2.7: Multicore works with --info-file, --rest-file, --wildcard-file

New in version 3.0: Multicore support for demultiplexing added.

Speed-up tricks¶

There are several tricks for limiting wall-clock time while using Cutadapt.

-Z (equivalent to --compression-level=1) can be used to limit the amount of CPU time which is spent on the compression of output files. Alternatively, choosing filenames not ending with .gz, .bz2 or .xz will make sure no CPU time is spent on compression at all. On systems with slow I/O, it can actually be faster to set a higher compression-level than 1.

Increasing the number of cores with -j will increase the number of reads per minute at near-linear rate.

It is also possible to use pipes in order to bypass the filesystem and pipe cutadapt’s output into an aligner such as BWA. The mkfifo command allows you to create named pipes in bash.

This command will run cutadapt and BWA simultaneously, using Cutadapt’s output as BWA’s input, and capturing Cutadapt’s report in cutadapt.report.

Read processing stages¶

Cutadapt can do a lot more in addition to removing adapters. There are various command-line options that make it possible to modify and filter reads and to redirect them to various output files. Each read is processed in the following order:

Read modification options are applied. This includes adapter removal, quality trimming, read name modifications etc. The order in which they are applied is the order in which they are listed in the help shown by cutadapt --help under the “Additional read modifications” heading. Adapter trimming itself does not appear in that list and is done after quality trimming and before length trimming (--length/-l).
Filtering options are applied, such as removal of too short or untrimmed reads. Some of the filters also allow to redirect a read to a separate output file. The filters are applied in the order in which they are listed in the help shown by cutadapt --help under the “Filtering of processed reads” heading.
If the read has passed all the filters, it is written to the output file.

Adapter types¶

Cutadapt can detect multiple adapter types. 5’ adapters preceed the sequence of interest and 3’ adapters follow it. Further distinctions are made according to where in the read the adapter sequence is allowed to occur.

Adapter type	Command-line option
Regular 3’ adapter	`-a ADAPTER`
Regular 5’ adapter	`-g ADAPTER`
Non-internal 3’ adapter	`-a ADAPTERX`
Non-internal 5’ adapter	`-g XADAPTER`
Anchored 3’ adapter	`-a ADAPTER$`
Anchored 5’ adapter	`-g ^ADAPTER`
5’ or 3’ (both possible)	`-b ADAPTER`
Linked adapter	`-a ^ADAPTER1...ADAPTER2` `-g ADAPTER1...ADAPTER2`

By default, all adapters are searched error-tolerantly. Adapter sequences may also contain any IUPAC wildcard character (degenerate bases) (such as N).

In addition, it is possible to remove a fixed number of bases from the beginning or end of each read, to remove low-quality bases (quality trimming) from the 3’ and 5’ ends, and to search for adapters also in the reverse-complemented reads.

Overview of adapter types¶

3’ adapter types¶

A 3’ adapter is assumed to be ligated to the 3’ end of your sequence of interest. When such an adapter is found, the adapter sequence itself and the sequence following it (if there is any) are trimmed. This table shows in which ways the different 3’ adapter types are allowed to occur in a read in order to be recognized by the program.

Adapter location in read	Read layout	Found by regular 3’ `-a ADAPTER`	Found by non-internal 3’ `-a ADAPTERX`	Found by anchored 3’ `-a ADAPTER$`
Full adapter sequence anywhere	acgtacgtADAPTERacgt	yes	no	no
Partial adapter sequence at 3’ end	acgtacgtacgtADAP	yes	yes	no
Full adapter sequence at 3’ end	acgtacgtacgtADAPTER	yes	yes	yes

5’ adapter types¶

A 5’ adapter is assumed to be ligated to the 5’ end of your sequence of interest. When such an adapter is found, the adapter sequence itself and the sequence preceding it (if there is any) are trimmed. This table shows in which ways the different 5’ adapter types are allowed to occur in a read in order to be recognized by the program.

Adapter location in read	Read layout	Found by regular 5’ `-g ADAPTER`	Found by non-internal 5’ `-g XADAPTER`	Found by anchored 5’ `-g ^ADAPTER`
Full adapter sequence anywhere	acgtADAPTERacgtacgt	yes	no	no
Partial adapter sequence at 5’ end	PTERacgtacgtacgt	yes	yes	no
Full adapter sequence at 5’ end	ADAPTERacgtacgtacgt	yes	yes	yes

Regular 3’ adapters¶

A 3’ adapter is a piece of DNA ligated to the 3’ end of the DNA fragment of interest. The sequencer starts the sequencing process at the 5’ end of the fragment. If the fragment is shorter than the read length, the sequencer will sequence into the adapter and the reads will thus contain some part of the adapter. Depending on how much longer the read is than the fragment of interest, the adapter occurs 1) not at all, 2) partially or fully at the end of the read (not followed by any other bases), or 3) in full somewhere within the read, followed by some other bases.

Use Cutadapt’s -a option to find and trim such an adapter, allowing both partial and full occurrences.

For example, assume your fragment of interest is mysequence and the adapter is ADAPTER. Depending on the read length, you will get reads that look like this:

mysequen
mysequenceADAP
mysequenceADAPTER
mysequenceADAPTERsomethingelse

Using -a ADAPTER to remove this type of adapter, this will be the result:

mysequen
mysequence
mysequence
mysequence

As this example shows, Cutadapt allows regular 3’ adapters to occur in full anywhere within the read (preceeded and/or succeeded by zero or more bases), and also partially degraded at the 3’ end. Cutadapt deals with 3’ adapters by removing the adapter itself and any sequence that may follow. As a consequence, a sequence that starts with an adapter, like this, will be trimmed to an empty read:

ADAPTERsomething

By default, empty reads are kept and will appear in the output. If you do not want this, use the --minimum-length/-m filtering option.

Regular 5’ adapters¶

Note

Unless your adapter may also occur in a degraded form, you probably want to use an anchored 5’ adapter.

A 5’ adapter is a piece of DNA ligated to the 5’ end of the DNA fragment of interest. For this type of adapter to be found, the adapter sequence needs to either appear in full somewhere within the read (internal match) or at the start (5’ end) of it, where in the latter case also partial occurrences are allowed. In all cases, the adapter itself and the sequence preceding it is removed.

Assume your fragment of interest is mysequence and the adapter is ADAPTER. The reads may look like this:

ADAPTERmysequence
DAPTERmysequence
TERmysequence
somethingADAPTERmysequence

All the above sequences are trimmed to mysequence when you use -g ADAPTER. As with 3’ adapters, the resulting read may have a length of zero when the sequence ends with the adapter. For example, the read

somethingADAPTER

will be empty after trimming.

Anchored 5’ adapters¶

An anchored 5’ adapter is an adapter that is expected to occur in full length at the beginning of the read. Example:

ADAPTERsomething

This is usually how forward PCR primers are found in the read in amplicon sequencing, for instance. In Cutadapt’s terminology, this type of adapter is called “anchored” to distinguish it from “regular” 5’ adapters, which are 5’ adapters with a less strict placement requirement.

If the adapter sequence is ADAPTER, use -g ^ADAPTER to remove an anchored 5’ adapter. The ^ is meant to indicate the “anchoring” to the beginning of the read. With this, the example read ADAPTERsomething is trimmed to just something.

An anchored 5’ adapter must occur in full at the beginning of the read. If the read happens to be shorter than the adapter, partial occurrences such as ADAPT are not found.

The requirement for a full match at the beginning of the read is relaxed when Cutadapt searches error-tolerantly, as it does by default. In particular, insertions and deletions may allow reads such as these to be trimmed, assuming the maximum error rate is sufficiently high:

BADAPTERsomething
ADAPTE

The B in the beginning is seen as an insertion, and the missing R as a deletion. If you also want to prevent this from happening, use the option --no-indels, which disallows insertions and deletions entirely.

Anchored 3’ adapters¶

It is also possible to anchor 3’ adapters to the end of the read. This is useful, for example, if you work with merged overlapping paired-end reads. Add the $ character to the end of an adapter sequence specified via -a in order to anchor the adapter to the end of the read, such as -a ADAPTER$. The adapter will only be found if it occurs in full at the end of the read (that is, it must be a suffix of the read.

The requirement for a full match exactly at the end of the read is relaxed when Cutadapt searches error-tolerantly, as it does by default. You can disable insertions and deletions with --no-indels.

Anchored 3’ adapters work as if you had reversed the sequence and used an appropriate anchored 5’ adapter.

As an example, assume you have these reads:

mysequenceADAP
mysequenceADAPTER
mysequenceADAPTERsomethingelse

Using -a ADAPTER$ will result in:

mysequenceADAP
mysequence
mysequenceADAPTERsomethingelse

That is, only the middle read is trimmed at all.

Non-internal 5’ and 3’ adapters¶

The non-internal 5’ and 3’ adapter types disallow internal occurrences of the adapter sequence. This is like a less strict version of anchoring: The adapter must always be at one of the ends of the read, but - unlike anchored adapters - partial occurrences are also ok.

Use -a ADAPTERX (replace ADAPTER with your actual adapter sequence, but use a literal X) to disallow internal matches for a 3’ adapter. Use -g XADAPTER to disallow them for a 5’ adapter. Mnemonic: The X is not allowed to “shift into” the read.

Here are some examples for trimming reads with -a ADAPTERX:

Input read	Processed read
`mysequenceADAP`	`mysequence`
`mysequenceADAPTER`	`mysequence`
`mysequenceADAPTERsomethingelse`	`mysequenceADAPTERsomethingelse`

Here are some examples for trimming reads with -g XADAPTER:

Input read	Processed read
`APTERmysequence`	`mysequence`
`ADAPTERmysequence`	`mysequence`
`somethingelseADAPTERmysequence`	`somethingelseADAPTERmysequence`

New in version 1.17.

Linked adapters (combined 5’ and 3’ adapter)¶

If your sequence of interest is surrounded by a 5’ and a 3’ adapter, and you want to remove both adapters, then you can use a linked adapter. A linked adapter combines a 5’ and a 3’ adapter. By default, the adapters are not anchored, but in many cases, you should anchor the 5’ adapter by prefixing it with ^.

See the previous sections for what anchoring means.

Note

Cutadapt versions before 2.0 anchored the 5’ adapter within linked adapters automatically even if the initial ^ was not specified. If you have scripts written for Cutadapt versions earlier than 2.0, please add the ^ so that the behavior does not change!

Linked adapters are specified as two sequences separated by ... (three dots):

cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fastq.gz in.fastq.gz

If you anchor an adapter, it will also become marked as being required. If a required adapter cannot be found, the read will not be trimmed at all even if the other adapter occurs. If an adapter is not required, it is optional.

Also, when you use the --discard-untrimmed option (or --trimmed-only) with a linked adapter, then a read is considered to be trimmed only if all required adapters were found.

In the previous example, ADAPTER1 was anchored and therefore required, but ADAPTER2 was optional. Anchoring also ADAPTER2 (and making it required as well) would look like this:

cutadapt -a ^ADAPTER1...ADAPTER2$ -o out.fastq.gz in.fastq.gz

As an example, assume the 5’ adapter is FIRST, the 3’ adapter is SECOND and you have these input reads:

FIRSTmysequenceSECONDextrabases
FIRSTmysequenceSEC
FIRSTmyseque
anotherreadSECOND

Trimming with

cutadapt -a ^FIRST...SECOND -o output.fastq input.fastq

will result in

mysequence
mysequence
myseque
anotherreadSECOND

The 3’ adapter in the last read is not trimmed because the anchored 5’ adapter is required, but missing in the read.

Linked adapters do not work when used in combination with --info-file and --mask-adapter.

To provide adapter-search parameters for linked adapters, they need to be set for each constituent adapter separately, as in -g "ADAPTER1;min_overlap=5...ADAPTER2;min_overlap=6".

New in version 1.10.

New in version 1.13: Ability to anchor the 3’ adapter.

New in version 2.0: The 5’ adapter is no longer anchored by default.

Changing which adapters are required¶

As described, when you specify a linked adapter with -a, the adapters that are anchored become required, and the non-anchored adapters become optional. To change this, you can instead use -g to specify a linked adapter. In that case, both adapters are required (even if they are not anchored). This type of linked adapter type is especially suited for trimming CRISPR screening reads. For example:

cutadapt -g ADAPTER1...ADAPTER2 -o out.fastq.gz in.fastq.gz

Here, both ADAPTER1 and ADAPTER2 are not anchored, but they are required because -g was used.

The -g option does not cover all cases, so you can also mark each adapter explicitly as required or optional using the search parameters required and optional. This is the only way to make an anchored adapter optional. For example, to request that an anchored 5’ adapter (here ADAPTER1) should not be required, you can specify it like this

cutadapt -a "^ADAPTER1;optional...ADAPTER2" -o output.fastq.gz input.fastq.gz

New in version 1.13: Option -g added.

Changed in version 1.15: Option -g requires both adapters.

Linked adapter statistics¶

For linked adapters, the statistics report contains a line like this:

=== Adapter 1 ===

Sequence: AAAAAAAAA...TTTTTTTTTT; Type: linked; Length: 9+10; Trimmed: 3 times; Half matches: 2

The value for “Half matches” tells you how often only the 5’-side of the adapter was found, but not the 3’-side of it. This applies only to linked adapters with regular (non-anchored) 3’ adapters.

5’ or 3’ adapters¶

The last type of adapter is a combination of the 5’ and 3’ adapter. You can use it when your adapter is ligated to the 5’ end for some reads and to the 3’ end in other reads. This probably does not happen very often, and this adapter type was in fact originally implemented because the library preparation in an experiment did not work as it was supposed to.

For this type of adapter, the sequence is specified with -b ADAPTER (or use the longer spelling --anywhere ADAPTER). The adapter may appear in the beginning (even degraded), within the read, or at the end of the read (even partially). The decision which part of the read to remove is made as follows: If there is at least one base before the found adapter, then the adapter is considered to be a 3’ adapter and the adapter itself and everything following it is removed. Otherwise, the adapter is considered to be a 5’ adapter and it is removed from the read, but the sequence after it remains.

Here are some examples.

Read before trimming	Read after trimming	Detected adapter type
`MYSEQUENCEADAPTERSOMETHING`	`MYSEQUENCE`	3’ adapter
`MYSEQUENCEADAPTER`	`MYSEQUENCE`	3’ adapter
`MYSEQUENCEADAP`	`MYSEQUENCE`	3’ adapter
`MADAPTER`	`M`	3’ adapter
`ADAPTERMYSEQUENCE`	`MYSEQUENCE`	5’ adapter
`PTERMYSEQUENCE`	`MYSEQUENCE`	5’ adapter
`TERMYSEQUENCE`	`MYSEQUENCE`	5’ adapter

Multiple adapter occurrences within a single read¶

If a single read contains multiple copies of the same adapter, the basic rule is that the leftmost match is used for both 5’ and 3’ adapters. For example, when searching for a 3’ adapter in

cccccADAPTERgggggADAPTERttttt

the read will be trimmed to

ccccc

When the adapter is a 5’ adapter instead, the read will be trimmed to

gggggADAPTERttttt

For 5’ adapters, this can be changed so that the rightmost occurrence is found by using the rightmost search parameter, as in -g "ACGT;rightmost".

New in version 4.1: The rightmost search parameter

Adapter-search parameters¶

The adapter search algorithm has a few parameters specific to each adapter that control how the adapter sequence is found. The command-line options -e and -O set the maximum error rate and minimum overlap parameters (see details in the following sections) for all adapters listed via the -a/-b/-g etc. options. When trimming more than one adapter, it may be necessary to change search parameters for each adapter individually. You can do so by adding a semicolon and parameter=value to the end of the adapter sequence, as in -a "ADAPTER;max_error_rate=0.2". There are also “flags” that enable certain behavior. These are written without the =value part.

Multiple parameters can be set, as in -a "ADAPTER;max_error_rate=0.2;min_overlap=5". For linked adapters, search parameters need to be specified separately for each adapter as in -g "ADAPTER1;min_overlap=5...ADAPTER2;min_overlap=6".

Remember to add the quotation marks; otherwise the shell will interpret the semicolon as a separator between two commands.

The following parameters are supported:

Parameter	Global option	Adapter-specific parameter
Maximum error rate (default: 0.1)	`-e 0.2`	`ADAPTER;e=0.2` or `ADAPTER;max_errors=0.2` or `ADAPTER;max_error_rate=0.2`
Minimum overlap (default: 3)	`-O 5`	`ADAPTER;o=5` or `ADAPTER;min_overlap=5`
Disallow indels	`--no-indels`	`ADAPTER;noindels`
Allow indels (this is the default)		`ADAPTER;indels`
Allow matches anywhere		`ADAPTER;anywhere`
Linked adapter required		`ADAPTER;required`
Linked adapter optional		`ADAPTER;optional`
Find rightmost 5’ adapter occurrence		`ADAPTER;rightmost`

The minimum overlap length cannot be set for anchored adapters as these always need to occur at full length.

When using the file: notation to read in adapters from a FASTA file, it is possible to specify file-specific search parameters:

cutadapt -a "file:adapters.fa;min_overlap=5;noindels"

The individual adapter specifications in the FASTA file can also contain search parameters:

>adapter1
^ACGT;min_overlap=3
>adapter2
AACCGGT;noindels

More specific parameters override less specific ones:

Adapter-specific parameters override the file-specific settings
File-specific search parameters override the global settings

New in version 1.18: Syntax for setting adapter-specific search parameters

New in version 3.5: The indels and noindels parameters.

New in version 4.1: Support file-specific search parameters (when using the file: notation)

Error tolerance¶

All searches for adapter sequences are error tolerant. Allowed errors are mismatches, insertions and deletions. For example, if you search for the adapter sequence ADAPTER and the error tolerance is set appropriately (as explained below), then also ADABTER will be found (with 1 mismatch), as well as ADAPTR (with 1 deletion), and also ADAPPTER (with 1 insertion). If insertions and deletions are disabled with --no-indels, then mismatches are the only type of errors.

The level of error tolerance is determined by a maximum error rate, which is 0.1 (=10%) by default. An adapter occurrence is only found if the actual error rate of the match does not exceed the maximum error rate. The actual error rate is computed as the number of errors in the match divided by the length of the matching part of the adapter.

For example, an adapter match of length 8 containing 1 error has an error rate of 1/8=0.125. At the default maximum error rate 0.1, it would not be found, but a match of length 10 containing 1 error has an error rate of 1/10=0.1 and would be found.

Relating the number of errros to the length of the matching part of the adapter is important because Cutadapt allows for partial adapter occurrences (for the non-anchored adapter types). If only the absolute number of errors were used, shorter matches would be favored unfairly. For example, assume an adapter has 30 bases and we allow three errors over that length. If we allowed these three errors even for a partial occurrences of, for example, four bases, we can immediately see that this results in unexpected matches. Using the error rate as a criterion helps to keep sensitivity and specificity roughly the same over the possible lengths of the matches.

The -e option on the command line allows you to change the maximum error rate. If the value is between 0 and 1 (but not 1 exactly), then this sets the maximum error rate directly for all specified adapters. The default is -e 0.1. You can also use the adapter-specific parameter max_error_rate or max_errors or just e to override the default for a single adapter only. Examples: -a "ADAPTER;max_error_rate=0.15", -a "ADAPTER;e=0.15" (the quotation marks are necessary).

Alternatively, you can also specify a value of 1 or greater as the number of allowed errors, which is then converted to a maximum error rate for each adapter individually. For example, with an adapter of length 10, using -e 2 will set the maximum error rate to 0.2 for an adapter of length 10.

The value does not have to be an integer, and if you use an adapter type that allows partial matches, you may want to add 0.5 to the desired number of errors, which achieves that even slightly shorter than full-lengths matches will be allowed at the specified number of errors. In short, if you want to allow two errors, use -e 2.5.

This also works in the adapter-specific parameters. Examples: -a "ADAPTER;e=1", -a "ADAPTER;max_errors=2.5". Note that e, max_error_rate and max_errors are all equivalent and the decision whether a rate or an absolute number is meant is based on whether the given value is less than 1 or not.

The number of errors allowed for a given adapter match length is also shown under the “No. of allowed errors” heading in the report that Cutadapt prints:

Sequence: 'SOMEADAPTER'; Length: 11; Trimmed: 2 times.

No. of allowed errors:
0-9 bp: 0; 10-11 bp: 1

This tells us: For match lengths of 0-9 bases, zero errors are allowed and for matches of length 10-11 bases, one error is allowed.

New in version 2.11: Allow specifying the number of errors

N wildcard characters¶

Any N wildcard characters in the adapter sequence are skipped when computing the error rate. That is, they do not contribute to the length of a match. For example, the adapter sequence ACGTACNNNNNNNNGTACGT has a length of 20, but only 12 non-N-characters. At a maximum error rate of 0.1, only one error is allowed if this sequence is found in full in a read because 12·0.1=1.2, which is 1 when rounded down.

This is done because N bases cannot contribute to the number of errors. In previous versions, N wildcard characters did contribute to the match length, but this artificially inflates the number of allowed errors. For example, an adapter like N{18}CC (18 N wildcards followed by CC) would effectively match anywhere because the default error rate of 0.1 would allow for two errors, but there are only two non-N bases in the particular adapter.

However, even in previous versions, the location with the greatest number of matching bases is chosen as the best location for an adapter, so in many cases the adapter would still be placed properly.

New in version 2.0: Ignore N wildcards when computing the error rate.

Minimum overlap (reducing random matches)¶

Since Cutadapt allows partial matches between the read and the adapter sequence for most adapter types, short matches can occur by chance, leading to erroneously trimmed bases. For example, just by chance, we expect that roughly 25% of all reads end with a base that is identical to the first base of the adapter. To reduce the number of falsely trimmed bases, the alignment algorithm requires that at least three bases of the adapter are aligned to the read.

This minimum overlap length can be changed globally (for all adapters) with the parameter --overlap (or its short version -O). The option is ignored for anchored adapters since these do not allow partial matches.

Alternatively, use the adapter-specific parameter min_overlap to change it for a single adapter only. Example: -a "ADAPTER;min_overlap=5" (the quotation marks are necessary). For anchored adapters, attempting to set a minimum overlap this way will result in an error.

In linked adapters, the minimum overlap length is applied separately to the 5’ and the 3’ adapter.

If a read contains a partial adapter sequence shorter than the minimum overlap length, no match will be found (and therefore no bases are trimmed).

Requiring at least three bases to match is quite conservative. Even if no minimum overlap was required, we can compute that we lose only about 0.44 bases per read on average, see Section 2.3.3 in my thesis. With the default minimum overlap length of 3, only about 0.07 bases are lost per read.

When choosing an appropriate minimum overlap length, take into account that true adapter matches are also lost when the overlap length is higher than zero, reducing Cutadapt’s sensitivity.

It is possible that fewer bases are removed from a read than the minimum overlap length seems to imply. The overlap length is the number of bases in the adapter that got aligned to the read, which means that if there are deletions in the adapter, the corresponding part in the read will be shorter. (This is only relevant when the maximum allowed error rate and/or the minimum overlap length are changed such that at least one error is allowed over the given length.)

Allowing partial matches at both ends¶

The regular 5’ and 3’ adapter types allow partial adapter occurrences only at the 5’ and 3’ end of the read, respectively. To allow partial matches at both ends, you can use the anywhere adapter-specific parameter.

A 3’ adapter specified via -a ADAPTER will be found even when it occurs partially at the 3’ end, as in mysequenceADAPT. However, it will by default not be found if it occurs partially at the 5’ end, as in APTERmysequence. To find the adapter in both cases, specify the adapter as -a "ADAPTER;anywhere".

Similarly, for a 5’ adapter specified via -g ADAPTER, partial matches at the 3’ end are not found, as in mysequenceADAPT. To allow partial matches at both ends, use -g "ADAPTER;anywhere".

Note

With anywhere, partial matches at the end that is usually not allowed to be matched will result in empty reads! This means that short random matches have a much greater detrimental effect and you should increase the minimum overlap length.

Searching reverse complements¶

By default, Cutadapt expects adapters to be given in the same orientation (5’ to 3’) as the reads. That is, neither reads nor adapters are reverse-complemented.

To change this, use option --revcomp or its abbreviation --rc. If given, Cutadapt searches both the read and its reverse complement for adapters. If the reverse complemented read yields a better match, then that version of the read is kept. That is, the output file will contain the reverse-complemented sequence. This can be used to “normalize” read orientation/strandedness.

To determine which version of the read yields the better match, the full adapter search (possibly multiple rounds if --times is used) is done independently on both versions, and the version that results in the higher number of matching nucleotides is considered to be the better one.

The name of a reverse-complemented read is changed by adding a space and rc to it. (Please file an issue if you would like this to be configurable.)

The report will show the number of reads that were reverse-complemented, like this:

Total reads processed:  60
Reads with adapters:    50 (83.3%)
Reverse-complemented:   20 (33.3%)

Here, 20 reverse-complemented reads contain an adapter and 50 - 20 = 30 reads that did not need to be reverse-complemented contain an adapter.

Option --revcomp is currently available only for single-end data.

New in version 2.8.

Specifying adapter sequences¶

Wildcards¶

All IUPAC nucleotide codes (wildcard characters, degenerate bases) are supported. For example, use an N in the adapter sequence to match any nucleotide in the read, or use -a YACGT for an adapter that matches both CACGT and TACGT. The wildcard character N is useful for trimming adapters with an embedded variable barcode:

cutadapt -a ACGTAANNNNTTAGC -o output.fastq input.fastq

Even the X wildcard that does not match any nucleotide is supported. If used as in -a ADAPTERX or -g XADAPTER, it acquires a special meaning for the matching algorithm and disallows internal adapter matches.

The character I, used to encode the base inosine, is automatically replaced with N within the adapter sequence.

Wildcard characters are by default only allowed in adapter sequences and are not recognized when they occur in a read. This is to avoid matches in reads that consist of many (often low-quality) N bases. Use --match-read-wildcards to enable wildcards also in reads.

Use the option -N to disable interpretation of wildcard characters even in the adapters. If wildcards are disabled entirely, that is, when you use -N and do not use --match-read-wildcards, then Cutadapt compares characters by their ASCII value. Thus, both the read and adapter can be arbitrary strings (such as SEQUENCE or ADAPTER as used here in the examples).

New in version 4.2: Inosine I

Repeated bases¶

If you have many repeated bases in the adapter sequence, such as many N s or many A s, you do not have to spell them out. For example, instead of writing ten A in a row (AAAAAAAAAA), write A{10} instead. The number within the curly braces specifies how often the character that preceeds it will be repeated. This works also for IUPAC wildcard characters, as in N{5}.

It is recommended that you use quotation marks around your adapter sequence if you use this feature, as in -a "N{5}ACGT".

Modifying reads¶

This section describes in which ways reads can be modified other than adapter removal.

`--action` changes what is done when an adapter is found¶

The --action option can be used to change what is done when an adapter match is found in a read.

The default is --action=trim, which will remove the adapter and the sequence before or after it from the read. For 5’ adapters, the adapter and the sequence preceding it is removed. For 3’ adapters, the adapter and the sequence following it is removed. Since linked adapters are a combination of a 5’ and 3’ adapter, in effect only the sequence between the 5’ and the 3’ adapter matches is kept.

With --action=retain, the read is trimmed, but the adapter sequence itself is not removed. Up- and downstream sequences are removed in the same way as for the trim action. For linked adapters, both adapter sequences are kept.

Note

Because it is somewhat unclear what should happen, --action=retain can at the moment not be combined with --times (multiple rounds of adapter removal).

Use --action=none to not change the read even if there is a match. This is useful because the statistics will still be updated as before and because the read will still be considered “trimmed” for the read filtering options. Combining this with --untrimmed-output, for example, can be used to copy reads without adapters to a different file. Other read modification options, if used, may still change the read.

Use --action=mask to write N characters to those parts of the read that would otherwise have been removed.

Use --action=lowercase to change to lowercase those parts of the read that would otherwise have been removed. The rest is converted to uppercase.

New in version 3.1: The retain action.

Removing a fixed number of bases¶

By using the --cut option or its abbreviation -u, it is possible to unconditionally remove bases from the beginning or end of each read. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end.

For example, to remove the first five bases of each read:

cutadapt -u 5 -o trimmed.fastq reads.fastq

To remove the last seven bases of each read:

cutadapt -u -7 -o trimmed.fastq reads.fastq

The -u/--cut option can be combined with the other options, but the --cut is applied before any adapter trimming.

Quality trimming¶

The -q (or --quality-cutoff) parameter can be used to trim low-quality ends from reads. If you specify a single cutoff value, the 3’ end of each read is trimmed:

cutadapt -q 10 -o output.fastq input.fastq

For Illumina reads, this is sufficient as their quality is high at the beginning, but degrades towards the 3’ end.

It is also possible to also trim from the 5’ end by specifying two comma-separated cutoffs as 5’ cutoff,3’ cutoff. For example,

cutadapt -q 15,10 -o output.fastq input.fastq

will quality-trim the 5’ end with a cutoff of 15 and the 3’ end with a cutoff of 10. To only trim the 5’ end, use a cutoff of 0 for the 3’ end, as in -q 15,0.

Quality trimming is done before any adapter trimming.

For paired-end data, quality trimming is by default applied to both reads using the same cutoff(s). Use option -Q to specify different cutoffs for R2:

cutadapt -q 5 -Q 15,20 -o out.1.fastq -p out.2.fastq in.1.fastq in.2.fastq

To disable quality-trimming of R2, use -Q 0.

By default, quality values are assumed to be encoded as ascii(phred quality + 33). Nowadays, this should always be the case. Some old Illumina FASTQ files encode qualities as ascii(phred quality + 64). For those, you must add --quality-base=64 to the command line.

A description of the quality-trimming algorithm is also available. The algorithm is the same as used by BWA.

New in version 3.5: The -Q option

Quality trimming of reads using two-color chemistry (NextSeq)¶

Some Illumina instruments use a two-color chemistry to encode the four bases. This includes the NextSeq and the NovaSeq. In those instruments, a ‘dark cycle’ (with no detected color) encodes a G. However, dark cycles also occur when sequencing “falls off” the end of the fragment. The read then contains a run of high-quality, but incorrect “G” calls at its 3’ end.

Since the regular quality-trimming algorithm cannot deal with this situation, you need to use the --nextseq-trim option:

cutadapt --nextseq-trim=20 -o out.fastq input.fastq

This works like regular quality trimming (where one would use -q 20 instead), except that the qualities of G bases are ignored.

New in version 1.10.

Poly-A trimming¶

Use –poly-a` to trim poly-A tails. Poly-A trimming is done after adapter trimming.

New in version 4.4.

Shortening reads to a fixed length¶

To shorten each read down to a certain length, use the --length option or the short version -l:

cutadapt -l 10 -o output.fastq.gz input.fastq.gz

This shortens all reads from input.fastq.gz down to 10 bases. The removed bases are those on the 3’ end.

If you want to remove a fixed number of bases from each read, use the –cut option instead.

Modifying read names¶

If you feel the need to modify the names of processed reads, some of the following options may be useful.

These options exist; they are explained in more detail in the following sections:

--rename changes a read name according to a template.
--prefix (or -x) adds a prefix to read names.
--suffix (or -y) adds a suffix to read names.
--length-tag updates a “length tag” such as length= with the correct read length
--strip-suffix removes a known suffix from read names

The --prefix and --suffix options are outdated as they do not ensure that paired-end read names remain consistent, and you should prefer to use --rename. --prefix and --suffix can currently not be used together with --rename.

`--rename` renames reads¶

The --rename option can be used to rename both single-end and paired-end reads. This section describes how it can be used to rename single-end reads.

We use the following terminology: The FASTQ or FASTA record header line consists of a read ID and is optionally followed by a separator (whitespace) and a comment.

For example, in this FASTQ header, the read ID is read1234 and the comment is value=17 (sequence and qualities not shown):

@read1234 value=17

The --rename option expects a template string such as {id} extra_info {adapter_name} as a parameter. It can contain regular text and placeholders that consist of a name enclosed in curly braces ({placeholdername}). The character sequence \t will be replaced by a tab character (this is currently the only allowed escape sequence).

The read name will be set to the template string in which the placeholders are replaced with the actual values relevant for the current read.

The following placeholders are currently available for single-end reads:

{header} – the full, unchanged header
{id} – the read ID, that is, the part of the header before the first whitespace
{comment} – the part of the header after the whitespace following the ID
{adapter_name} – the name of adapter that was found in this read or no_adapter if there was no adapter match. If you use --times to do multiple rounds of adapter matching, this is the name of the last found adapter.
{match_sequence} – the sequence of the read that matched the adapter (including errors). If there was no adapter match, this is set to an empty string. If you use a linked adapter, this is to the two matching strings, separated by a comma.
{cut_prefix} – the prefix removed by the --cut (or -u) option (that is, when used with a positive length argument)
{cut_suffix} – the suffix removed by the --cut (or -u) option (that is, when used with a negative length argument)
{rc} – this is replaced with the string rc if the read was reverse complemented. This only applies when reverse complementing was requested.
\t – not a placeholder, but will be replaced with the tab character.

For example, assume you have this input read in in.fasta:

>myread extra info
ACGTAAAATTTTCCCC

Running the command

cutadapt -a myadapter=TTTT -u 4 --rename='{id} barcode={cut_prefix} adapter={adapter_name} {comment}' in.fasta

Will result in this modified read:

>myread barcode=ACGT adapter=myadapter extra info
AAAA

New in version 3.2: The {rn} placeholder.

New in version 3.3: The {rc} placeholder.

New in version 3.6: The {match_sequence} placeholder.

New in version 4.3: The \t escape sequence.

`--rename` also renames paired-end reads¶

If the --rename option is used with paired-end data, the template is applied separately to both R1 and R2. That is, for R1, the placeholders are replaced with values from R1, and for R2, the placeholders are replaced with values from R2. For example, {comment} becomes R1’s comment in R1 and it becomes R2’s comment in R2.

As another example, using --rename='{id} please note: {comment}', the paired-end reads

>myread important comment
...

>myread also quite important
...

are renamed to

>myread please note: important comment
...

>myread please note: also quite important
...

For paired-end data, the placeholder {rn} is available (“read number”), and it is replaced with 1 in R1 and with 2 in R2.

In addition, it is possible to write a placeholder as {r1.placeholdername} or {r2.placeholdername}, which always takes the replacement value from R1 or R2, respectively.

For example, assume R1 starts with a 4 nt barcode that you want to “move” from the sequence into the ID of both reads. You can use --cut=4 --rename='{id}_{r1.cut_prefix} {comment}' and the read pair

>myread this is R1
ACGTAAAATTTT

>myread this is R2
GGGGCCCC

will be changed to

>myread_ACGT this is R1
AAAATTTT

>myread_ACGT this is R2
GGGGCCCC

The {r1.placeholder} and {r2.placeholder} notation is available for all placeholders except {rn} and {id} because the read ID needs to be identical for both reads.

In general, the read IDs of R1 and R2 need to be identical. Cutadapt enforces this when reading paired-end FASTQ files, except that it allows a single trailing “1” or “2” as the only difference between the read IDs. This allows for read IDs ending in /1 and /2 (some old formats are like this) or .1 and .2 (fastq-dump produces this). If you use --rename, Cutadapt will also enforce this when writing paired-end reads.

New in version 3.2: The --rename option

Filtering reads¶

By default, all processed reads, no matter whether they were trimmed or not, are written to the output file specified by the -o option (or to standard output if -o was not provided). For paired-end reads, the second read in a pair is always written to the file specified by the -p option.

The options described here make it possible to filter reads by either discarding them entirely or by redirecting them to other files. When redirecting reads, the basic rule is that each read is written to at most one file. You cannot write reads to more than one output file.

Filters are applied to all processed reads, no matter whether they have been modified by adapter- or quality trimming.

--minimum-length LENGTH or -m LENGTH

Discard processed reads that are shorter than LENGTH.

If you do not use this option, reads that have a length of zero (empty reads) are kept in the output. Some downstream tools may have problems with zero-length sequences. In that case, specify at least -m 1.

--too-short-output FILE

Instead of discarding the reads that are too short according to -m, write them to FILE (in FASTA/FASTQ format).

--maximum-length LENGTH or -M LENGTH

Discard processed reads that are longer than LENGTH.

--too-long-output FILE

Instead of discarding reads that are too long (according to -M), write them to FILE (in FASTA/FASTQ format).

--untrimmed-output FILE

Write all reads without adapters to FILE (in FASTA/FASTQ format) instead of writing them to the regular output file.

--discard-trimmed

Discard reads in which an adapter was found.

--discard-untrimmed

Discard reads in which no adapter was found. This has the same effect as specifying --untrimmed-output /dev/null.

The options --too-short-output and --too-long-output are applied first. This means, for example, that a read that is too long will never end up in the --untrimmed-output file when --too-long-output was given, no matter whether it was trimmed or not.

The options --untrimmed-output, --discard-trimmed and -discard-untrimmed are mutually exclusive.

The following filtering options do not have a corresponding option for redirecting reads. They always discard those reads for which the filtering criterion applies.

--max-n COUNT_or_FRACTION: Discard reads with more than COUNT N bases. If COUNT_or_FRACTION is a number between 0 and 1, it is interpreted as a fraction of the read length
--max-expected-errors ERRORS or --max-ee ERRORS: Discard reads with more than ERRORS expected errors.
--discard-casava: Discard reads that did not pass CASAVA filtering. Illumina’s CASAVA pipeline in version 1.8 adds an is_filtered header field to each read. Specifying this option, the reads that did not pass filtering (these are the reads that have a Y for is_filtered) will be discarded. Reads for which the header cannot be recognized are kept.

Trimming paired-end reads¶

Cutadapt supports trimming of paired-end reads. To enable this, provide two input files and a second output file with the -p option (this is the short form of --paired-output). This is the basic command line syntax:

cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq

Here, the input reads are in reads.1.fastq and reads.2.fastq, and the result will be written to out.1.fastq and out.2.fastq.

In paired-end mode, the options -a, -b, -g and -u that also exist in single-end mode are applied to the forward reads only. To modify the reverse read, these options have uppercase versions -A, -B, -G and -U that work just like their counterparts. In the example above, ADAPTER_FWD will therefore be trimmed from the forward reads and ADAPTER_REV from the reverse reads.

Single-end/R1 option	Corresponding option for R2
`--adapter`, `-a`	`-A`
`--front`, `-g`	`-G`
`--anywhere`, `-b`	`-B`
`--cut`, `-u`	`-U`
`--output`, `-o`	`--paired-output`, `-p`

In paired-end mode, Cutadapt checks whether the input files are properly paired. An error is raised if one of the files contains more reads than the other or if the read names in the two files do not match. The read name comparison ignores a trailing /1 or /2 to allow processing some old Illumina paired-end files.

In some cases, it works to run Cutadapt twice in single-end mode on the input files, but we recommend against it as this skips the consistency checks that Cutadapt can do otherwise.

Also, as soon as you start to use one of the filtering options that discard reads, it is mandatory you process both files at the same time to make sure that the output files are kept synchronized. If a read is removed from one of the files, Cutadapt will always ensure that it is also removed from the other file.

The following command-line options are applied to both reads:

-q (along with --quality-base)
--times applies to all the adapters given
--trim-n
--action
--length
--length-tag
--prefix, --suffix

The following limitations still exist:

The --info-file, --rest-file and --wildcard-file options write out information only from the first read.

Filtering paired-end reads¶

The filtering options listed above can also be used when trimming paired-end data.

Importantly, Cutadapt always discards both reads of a pair if it determines that the pair should be discarded. This ensures that the reads in the output files are in sync. (If you don’t want or need this, you can run Cutadapt separately on the R1 and R2 files.)

The same applies also to the options that redirect reads to other files if they fulfill a filtering criterion, such as --too-short-output/--too-short-paired-output. That is, the reads are always sent in pairs to these alternative output files.

The --pair-filter option determines how to combine the filters for R1 and R2 into a single decision about the read pair.

The default is --pair-filter=any, which means that a read pair is discarded (or redirected) if at least one of the reads (R1 or R2) fulfills the filtering criterion. As an example, if option --minimum-length=20 is used and paired-end data is processed, a read pair is discarded if at least one of the reads is shorter than 20 nt.

With --pair-filter=both, you can require that filtering criteria must apply to both reads in order for a read pair to be discarded.

Finally, --pair-filter=first will make a decision about the read pair by inspecting whether the filtering criterion applies to the first read, ignoring the second read.

The following table describes the effect for some filtering options.

Filtering option	With `--pair-filter=any`, the pair is discarded if …	With `--pair-filter=both`, the pair is discarded if …
`--minimum-length`	one of the reads is too short	both reads are too short
`--maximum-length`	one of the reads is too long	both reads are too long
`--discard-trimmed`	one of the reads contains an adapter	both reads contain an adapter
`--discard-untrimmed`	one of the reads does not contain an adapter	both reads do not contain an adapter
`--max-n`	one of the reads contains too many `N` bases	both reads contain too many `N` bases

There is currently no way to change the pair-filter mode for each filter individually.

Note

As an exception, when you specify adapters only for R1 (-a/-g/-b) or only for R2 (-A/-G/-B), then the --pair-filter mode for --discard-untrimmed is forced to be both (and accordingly, also for the --untrimmed-(paired-)output options).

Otherwise, with the default --pair-filter=any setting, all pairs would be considered untrimmed because it would always be the case that one of the reads in the pair does not contain an adapter.

The pair-filter mode for the other filtering options, such as --minimum-length, is not overridden in the same way and remains any unless changed explicitly with the --pair-filter option.

These are the paired-end specific filtering and output options:

--minimum-length LENGTH1:LENGTH2 or -m LENGTH1:LENGTH2: When trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:). If the colon syntax is not used, the same minimum length applies to both reads, as discussed above. Also, one of the values can be omitted to impose no restrictions. For example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.
--maximum-length LENGTH1:LENGTH2 or -M LENGTH1:LENGTH2: Maximum lengths can also be specified separately, see the explanation of -m above.
--paired-output FILE or -p FILE: Write the second read of each processed pair to FILE (in FASTA/FASTQ format).
--untrimmed-paired-output FILE: Used together with --untrimmed-output. The second read in a pair is written to this file when the processed pair was not trimmed.
--too-short-paired-output FILE: Write the second read in a pair to this file if pair is too short. Use together with --too-short-output.
--too-long-paired-output FILE: Write the second read in a pair to this file if pair is too long. Use together with --too-long-output.
--pair-filter=(any|both|first): Which of the reads in a paired-end read have to match the filtering criterion in order for it to be filtered.

Note that the option names can be abbreviated as long as it is clear which option is meant (unique prefix). For example, instead of --untrimmed-output and --untrimmed-paired-output, you can write --untrimmed-o and --untrimmed-p.

New in version 1.18: --pair-filter=first

Paired adapters¶

When processing paired-end data, Cutadapt has two sets of adapters to work with: The ones that are to be found and removed in the forward read (R1), specified with -a/-g/-b, and the ones to be found and removed in the reverse read (R2), specified with -A/-G/-B.

Normally, the program looks at the R1 and R2 reads independently. That is, the best matching R1 adapter is removed from R1 and the best matching R2 adapter is removed from R2.

To change this, the option --pair-adapters can be used. It causes each R1 adapter to be paired up with its corresponding R2 adapters. The first R1 adapter will be paired up with the first R2 adapter, and so on. The adapters are then always removed in pairs from a read pair. It is an error if the number of provided adapters is not identical for the R1 and R2 sets.

Example:

cutadapt --pair-adapters -a AAAAA -a GGGG -A CCCCC -a TTTT -o out.1.fastq -p out.2.fastq in.1.fastq in.2.fastq

Here, the adapter pairs are (AAAAA, CCCCC) and (GGGG, TTTT). That is, paired-end reads will only be trimmed if either

AAAAA is found in R1 and CCCCC is found in R2,
or GGGG is found in R1 and TTTT is found in R2.

There is one limitation of the algorithm at the moment: The program looks for the best-matching R1 adapter first and then checks whether the corresponding R2 adapter can be found. If not, the read pair remains unchanged. However, it is in theory possible that a different R1 adapter that does not fit as well would have a partner that can be found. Some read pairs may therefore remain untrimmed.

This option was added to help with demultiplexing Illumina unique dual indices (UDIs).

New in version 2.1.

Interleaved paired-end reads¶

Cutadapt supports reading and writing paired-end reads from a single FASTQ file in which the entries for the first and second read from each pair alternate. The first read in each pair comes before the second. This is called “interleaved” format. Enable this file format by adding the --interleaved option to the command-line. Then, if you provide only a single file where usually two would be expected, reads are automatically read or written interleaved.

For example, to read interleaved from reads.fastq and to write interleaved to trimmed.fastq:

cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.fastq reads.fastq

In the following example, the input reads.fastq is interleaved, but output is written to two files trimmed.1.fastq and trimmed.2.fastq:

cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq -p trimmed.2.fastq reads.fastq

Reading two-file input and writing interleaved is also possible by providing a second input file:

cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq reads.1.fastq reads.2.fastq

The following options also supported interleaved output:

* ``--untrimmed-output`` (omit ``--untrimmed-paired-output``)
* ``--too-short-output`` (omit ``--too-short-paired-output``)
* ``--too-long-output`` (omit ``--too-long-paired-output``)

If you omit --interleaved but trim paired-end files, the above options must be used in pairs.

Cutadapt will detect if an input file is not properly interleaved by checking whether read names match and whether the file contains an even number of entries.

Trimming paired-end reads separately¶

Warning

Trimming paired-end data in this way is not recommended as it bypasses all paired-end error-checking, such as checking whether the number of reads is the same in both files. You should use the normal paired-end trimming mode with the -o/--p options described above.

If you do not use any of the filtering options that discard reads, such as --discard, --minimum-length or --maximum-length, you can run Cutadapt on each file separately:

cutadapt -a ADAPTER_FWD -o trimmed.1.fastq.gz reads1.fastq.gz
cutadapt -a ADAPTER_REV -o trimmed.2.fastq.gz reads2.fastq.gz

You can use the options that are listed under ‘Additional modifications’ in Cutadapt’s help output without problems. For example, if you want to quality-trim the first read in each pair with a threshold of 10, and the second read in each pair with a threshold of 15, then the commands could be:

cutadapt -q 10 -a ADAPTER_FWD -o trimmed.1.fastq reads1.fastq
cutadapt -q 15 -a ADAPTER_REV -o trimmed.2.fastq reads2.fastq

Note

Previous Cutadapt versions (up to 1.18) had a “legacy mode” that was activated under certain conditions and in which the read-modifying options such as -q would only apply to the forward/R1 reads. This mode no longer exists.

Multiple adapters¶

It is possible to specify more than one adapter sequence by using the options -a, -b and -g more than once. Any combination is allowed, such as five -a adapters and two -g adapters. Each read will be searched for all given adapters, but only the best matching adapter is removed. (But it is possible to trim more than one adapter from each read). This is how a command may look to trim one of two possible 3’ adapters:

cutadapt -a TGAGACACGCA -a AGGCACACAGGG -o output.fastq input.fastq

The adapter sequences can also be read from a FASTA file. Instead of giving an explicit adapter sequence, you need to write file: followed by the name of the FASTA file:

cutadapt -a file:adapters.fasta -o output.fastq input.fastq

All of the sequences in the file adapters.fasta will be used as 3’ adapters. The other adapter options -b and -g also support this.

With -g, you can also write -g ^file:adapters.fasta to specify that all adapters read from adapters.fasta should be anchored.

Similarly, with -a, you can also write -a file$:adapters.fasta to anchor all adapters to the 3’ end.

The file: syntax can be combined with the regular way of specifying an adapter. But no matter how you specify multiple adapter sequences, remember that only the best matching adapter is trimmed from each read.

When Cutadapt has multiple adapter sequences to work with, either specified explicitly on the command line or via a FASTA file, it decides in the following way which adapter should be trimmed:

All given adapter sequences are matched to the read.
Adapter matches where the overlap length (see the -O parameter) is too small or where the error rate is too high (-e) are removed from further consideration.
Among the remaining matches, the one with the largest alignment score is chosen.
If there is a tie, the first adapter wins. The order of adapters is the order in which they are given on the command line or in which they are found in the FASTA file.

If your adapter sequences are all similar and differ only by a variable barcode sequence, you can use a single adapter sequence instead that contains wildcard characters.

If you want to search for a combination of a 5’ and a 3’ adapter, you may want to provide them as a single so-called “linked adapter” instead.

New in version 4.1: Ability to anchor 5’ adapters from an external file with -g ^file:

New in version 4.3: Ability to anchor 3’ adapters from an external file with -a file$:

Named adapters¶

Cutadapt reports statistics for each adapter separately. To identify the adapters, they are numbered and the adapter sequence is also printed:

=== Adapter 1 ===

Sequence: AACCGGTT; Length 8; Trimmed: 5 times.

If you want this to look a bit nicer, you can give each adapter a name in this way:

cutadapt -a My_Adapter=AACCGGTT -o output.fastq input.fastq

The actual adapter sequence in this example is AACCGGTT and the name assigned to it is My_Adapter. The report will then contain this name in addition to the other information:

=== Adapter 'My_Adapter' ===

Sequence: TTAGACATATCTCCGTCG; Length 18; Trimmed: 5 times.

When adapters are read from a FASTA file, the sequence header is used as the adapter name.

Adapter names are also used in column 8 of info files.

Trimming more than one adapter from each read¶

By default, at most one adapter sequence is removed from each read, even if multiple adapter sequences were provided. This can be changed by using the --times option (or its abbreviated form -n). Cutadapt will then search for all the given adapter sequences repeatedly, either until no adapter match was found or until the specified number of rounds was reached.

As an example, assume you have a protocol in which a 5’ adapter gets ligated to your DNA fragment, but it’s possible that the adapter is ligated more than once. So your sequence could look like this:

ADAPTERADAPTERADAPTERmysequence

To be on the safe side, you assume that there are at most five copies of the adapter sequence. This command can be used to trim the reads correctly:

cutadapt -g ^ADAPTER -n 5 -o output.fastq.gz input.fastq.gz

To search for a combination of a 5’ and a 3’ adapter, have a look at the support for “linked adapters” instead, which works better for that particular case because it is allows you to require that the 3’ adapter is trimmed only when the 5’ adapter also occurs, and it cannot happen that the same adapter is trimmed twice.

Before Cutadapt supported linked adapters, the --times option was the recommended way to search for 5’/3’ linked adapters. For completeness, we describe how it was done. For example, when the 5’ adapter is FIRST and the 3’ adapter is SECOND, then the read could look like this:

FIRSTmysequenceSECOND

That is, the sequence of interest is framed by the 5’ and the 3’ adapter. The following command would be used to trim such a read:

cutadapt -g ^FIRST -a SECOND -n 2 ...

Demultiplexing¶

Cutadapt supports demultiplexing, which means that reads are written to different output files depending on which adapter was found in them. To use this, include the string {name} in the name of the output file and give each adapter a name. The path is then interpreted as a template and each trimmed read is written to the path in which {name} is replaced with the name of the adapter that was found in the read. Reads in which no adapter was found will be written to a file in which {name} is replaced with unknown.

Example:

cutadapt -a one=TATA -a two=GCGC -o trimmed-{name}.fastq.gz input.fastq.gz

This command will create the three files demulti-one.fastq.gz, demulti-two.fastq.gz and demulti-unknown.fastq.gz.

More realistically, your “adapters” would actually be barcode sequences that you will want to provide in a FASTA file. Here is a made-up example for such a barcodes.fasta file:

>barcode01
TTAAGGCC
>barcode02
TAGCTAGC
>barcode03
ATGATGAT

Since our barcodes are located at the 5’ end of the R1 read, we use the -g option to provide Cutadapt with the adapter sequences, as in -g ^file:barcodes.fasta. Also, we prefix the ^file: with the ^ character to specify that we want to anchor the 5’ adapters.

Since these barcode sequences have a length of 8 and the default maximum error rate is 10%, Cutadapt would by default not allow any errors when matching them (a single error would result in an error rate of 1/8=12.5%). We therefore use -e 1 to allow one error.

Here is the final command:

cutadapt -e 1 -g ^file:barcodes.fasta -o "trimmed-{name}.fastq.gz" input.fastq.gz

Demultiplexing is also supported for paired-end data if you provide the {name} template in both output file names (-o and -p). Example:

cutadapt -e 1 -g ^file:barcodes.fasta -o trimmed-{name}.1.fastq.gz -p trimmed-{name}.2.fastq.gz input.1.fastq.gz input.2.fastq.gz

Paired-end demultiplexing always uses the adapter matches of the first read to decide where a read should be written. If adapters for read 2 are given (-A/-G), they are detected and removed as normal, but these matches do not influence where the read pair is written. This is to ensure that read 1 and read 2 are always synchronized.

To demultiplex using a barcode that is located on read 2, you can “cheat” and swap the roles of R1 and R2 for both the input and output files

cutadapt -e 1 -g ^file:barcodes.fasta -o trimmed-{name}.2.fastq.gz -p trimmed-{name}.1.fastq.gz input.2.fastq.gz input.1.fastq.gz

If you do this in a script or pipeline, it may be a good idea to add a comment to clarify that this reversal of R1 and R2 is intended.

More advice on demultiplexing:

You can use --untrimmed-output to change the name of the output file that receives the untrimmed reads (those in which no barcode could be found).
Similarly, you can use --untrimmed-paired-output to change the name of the output file that receives the untrimmed R2 reads.
If you want to demultiplex, but keep the barcode in the reads, use the option --action=none.

Demultiplexing paired-end reads with combinatorial dual indexes¶

Illumina’s combinatorial dual indexing strategy uses a set of indexed adapters on R1 and another one on R2. Unlike unique dual indexes (UDI) (described on the same page) all combinations of indexes are possible.

For demultiplexing this type of data (“combinatorial demultiplexing”), it is necessary to write each read pair to an output file depending on the adapters found on R1 and R2.

Doing this is similar to doing normal demultiplexing as described above, but you need to use {name1} and {name2} in both output file name templates. For example:

cutadapt \
    -e 0.15 --no-indels \
    -g ^file:barcodes_fwd.fasta \
    -G ^file:barcodes_rev.fasta \
    -o {name1}-{name2}.1.fastq.gz -p {name1}-{name2}.2.fastq.gz \
    input.1.fastq.gz input.2.fastq.gz

The {name1} will be replaced with the name of the best-matching R1 adapter and {name2} will be replaced with the name of the best-matching R2 adapter.

If there was no match of an R1 adapter, {name1} is set to “unknown”, and if there is no match of an R2 adapter, {name2} is set to “unknown”. To discard read pairs for which one or both adapters could not be found, use --discard-untrimmed.

The --untrimmed-output and --untrimmed-paired-output options cannot be used.

Read the demultiplexing section for how to choose the error rate etc. Also, the tips below about how to speed up demultiplexing apply even with combinatorial demultiplexing.

When doing the above, you will end up with lots of files named first-second.x.fastq.gz, where first is the name of the first indexed adapter and second is the name of the second indexed adapter, and x is 1 or 2. Each indexed adapter combination may correspond to a sample name and you may want to name your files according to the sample name, not the name of the adapters. Cutadapt does not have built-in functionality to achieve this, but you can use an external tool such as mmv (“multiple move”). First, create a list of patterns in patterns.txt:

fwdindex1-revindex1.[12].fastq.gz sampleA.#1.fastq.gz
fwdindex1-revindex2.[12].fastq.gz sampleB.#1.fastq.gz
fwdindex1-revindex3.[12].fastq.gz sampleC.#1.fastq.gz
fwdindex2-revindex1.[12].fastq.gz sampleD.#1.fastq.gz
fwdindex2-revindex2.[12].fastq.gz sampleE.#1.fastq.gz
...

Here, fwdindex1/revindex1 etc. are the names of indexes, and sampleA etc. are your sample names. Then rename all files at once with

mmv < patterns.txt

New in version 2.4.

Demultiplexing unique dual indices¶

Illumina’s unique dual indexing (UDI) scheme (“non-redundant indexing”) uses 96 unique i5 indices and 96 unique i7 indices, which are only used in pairs. That is, the first i5 index is always used with the first i7 index and so on.

To demultiplex this type of data, the –pair-adapters option needs to be used. Example:

cutadapt -j 8 -e 1 --no-indels --pair-adapters -g ^file:i5indices.fasta -G ^file:i7indices.fasta -o 'demultiplexed-{name}_R1.fastq.gz' -p 'demultiplexed-{name}_R2.fastq.gz' input.R1.fastq.gz input.R2.fastq.gz

Note

If the adapters do not come in pairs, but all combinations are possible, use combinatorial demultiplexing.

Speeding up demultiplexing¶

Finding many adapters/barcodes simultaneously (which is what demultiplexing in Cutadapt is about), can be sped up tremendously by using the right options since Cutadapt will then be able to create an index of the barcode sequences instead of checking for each barcode separately. Currently, the following conditions need to be met in order for index creation to be enabled:

The barcodes/adapters must be anchored: For 5’ adapters, use -g ^ADAPTER or -g ^file:adapters.fasta. For 3’ adapters, use -a ADAPTER$ or -a file$:adapters.fasta.
The maximum error rate (-e) must be set such that at most 2 errors are allowed: Use -e 0, -e 1 or -e 2.
No IUPAC wildcards must be used in the barcode/adapter. Also, you cannot use the option --match-read-wildcards.

An index will be built for all the adapters that fulfill these criteria if there are at least two of them. You can provide additional adapters/barcodes, and they will just not be included in the index. Whether an index is created or not should not affect the results, only how fast you get them.

To see whether an index is created, look for a message like this in the first few lines of Cutadapt’s output:

Building index of 23 adapters ...

Hopefully some of the above restrictions will be lifted in the future.

New in version 1.15: Demultiplexing of paired-end data.

New in version 2.0: Added ability to use an index of adapters for speeding up demultiplexing

New in version 3.0: An index can be built even when indels are allowed (that is, --no-indels is no longer required).

Demultiplexing paired-end reads in mixed orientation¶

For some protocols, the barcode will be located either on R1 or on R2 depending on the orientation in which the DNA fragment was sequenced.

For example, the read layout could be either this

R1: barcode-forwardprimer-sequence  R2: reverseprimer-sequence

or this

R1: reverseprimer-sequence  R2: barcode-forwardprimer-sequence

To demultiplex such data with Cutadapt, choose one of the orientations first and demultiplex the reads as if only that existed in the data, using a command like this

cutadapt -g ^file:barcodes.fasta \
    -o round1-{name}.R1.fastq.gz \
    -p round1-{name}.R2.fastq.gz \
    R1.fastq.gz R2.fastq.gz

Then all the read pairs in which no barcode could be found will end up in round1-unknown.R1.fastq.gz and round1-unknown.R2.fastq.gz. This will also include the pairs in which the barcode was not actually in R1, but in R2. To demultiplex these reads as well, run Cutadapt a second time with those “unknown” files as input, but also reverse the roles of R1 and R2

cutadapt -g ^file:barcodes.fasta \
    -o round2-{name}.R2.fastq.gz \
    -p round2-{name}.R1.fastq.gz \
    round1-unknown.R2.fastq.gz round1-unknown.R1.fastq.gz

Illumina TruSeq¶

Illumina makes their adapter sequences available in the Illumina Adapter Sequences Document.

As an example for how to use that information with Cutadapt, we show how to trim TruSeq adapters. The document gives the adapter sequence for read 1 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and for read 2 as AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT. When using Cutadapt, this means you should trim your paired-end data as follows:

cutadapt \
    -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
    -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    -o trimmed.R1.fastq.gz -p trimmed.R2.fastq.gz \
    reads.R1.fastq.gz reads.R2.fastq.gz

Keep in mind that Cutadapt removes the adapter that it finds and also the sequence following it, so even if the actual adapter sequence that is used in a protocol is longer than that (and possibly contains a variable index), it is sufficient to specify a prefix of the sequence(s).

Note

Previous versions of this document also recommended using AGATCGGAAGAGC as adapter sequence for both read 1 and read 2, but you should avoid doing so as that sequence occurs multiple times in the human genome.

To understand the structure of Illumina libraries and what the i5, i7, P5, P7 sequences are, see this overview.

Some older information is also available in the document Illumina TruSeq Adapters De-Mystified, but keep in mind that it does not cover newer protocols.

Under some circumstances, you may want to consider not trimming adapters at all. For example, a good library prepared for exome, genome or transcriptome sequencing should contain very few reads with adapters anyway. Also, some read mapping programs including BWA-MEM and STAR will soft-clip bases at the 3’ ends of reads that do not match the reference, which will take care of adapters implicitly.

Warning about incomplete adapter sequences¶

Sometimes Cutadapt’s report ends with these lines:

WARNING:
    One or more of your adapter sequences may be incomplete.
    Please see the detailed output above.

Further up, you’ll see a message like this:

Bases preceding removed adapters:
  A: 95.5%
  C: 1.0%
  G: 1.6%
  T: 1.6%
  none/other: 0.3%
WARNING:
    The adapter is preceded by "A" extremely often.
    The provided adapter sequence may be incomplete.
    To fix the problem, add "A" to the beginning of the adapter sequence.

This means that in 95.5% of the cases in which an adapter was removed from a read, the base coming before that was an A. If your DNA fragments are not random, such as in amplicon sequencing, then this is to be expected and the warning can be ignored. If the DNA fragments are supposed to be random, then the message may be genuine: The adapter sequence may be incomplete and should include an additional A in the beginning.

This warning exists because some documents list the Illumina TruSeq adapters as starting with GATCGGA.... While that is technically correct, the library preparation actually results in an additional A before that sequence, which also needs to be removed. See the previous section for the correct sequence.

Dealing with `N` bases¶

Cutadapt supports the following options to deal with N bases in your reads:

--max-n COUNT

Discard reads containing more than COUNT N bases. A fractional COUNT between 0 and 1 can also be given and will be treated as the proportion of maximally allowed N bases in the read. For example, --max-n 0 removes all reads that contain any N bases.

--trim-n

Remove flanking N bases from each read. That is, a read such as this:

NNACGTACGTNNNN

Is trimmed to just ACGTACGT. This option is applied after adapter trimming. If you want to get rid of N bases before adapter removal, use quality trimming: N bases typically also have a low quality value associated with them.

Cutadapt’s output¶

Reporting¶

Cutadapt will by default print a full report after it has finished processing the reads. To suppress all output except error messages, use the option --quiet.

The report type can be changed to a one-line summary with the option --report=minimal. The output will be a tab-separated table (tsv) with one header row and one row of content. Here is an example:

$ cutadapt --report=minimal -a ... -m 20 -q 10 -o ... -p ... in.[12].fastq.gz
status in_reads in_bp     too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp w/adapters2 qualtrim2_bp out2_bp
OK     1000000  202000000 24827     0        0          975173    28968      1674222     97441426 0 0 98492473

This is the meaning of each column:

Column heading	Explanation
status	Incomplete adapter warning (`OK` or `WARN`)
in_reads	Number of processed reads (read pairs for paired-end)
in_bp	Number of processed basepairs
too_short	Number of reads/read pairs that were too short
too_long	Number of reads/read pairs that were too long
too_many_n	Number of reads/read pairs that contained too many `N`
out_reads	Number of reads written
w/adapters	Number of reads containing at least one adapter
qualtrim_bp	Number of bases removed from R1 reads by quality trimming
out_bp	Number of bases written to R1 reads
w/adapters2	Number of R2 reads containing at least one adapter
qualtrim2_bp	Number of bases removed from R2 reads by quality trimming
out2_bp	Number of bases written

The last three fields are omitted for single-end data.

New in version 1.18.

How to read the report¶

After every run, Cutadapt prints out per-adapter statistics. The output starts with something like this:

Sequence: 'ACGTACGTACGTTAGCTAGC'; Length: 20; Trimmed: 2402 times.

If option --revcomp was used, this line will additionally contain something like Reverse-complemented: 984 times. This describes how many times of the 2402 total times the adapter was found on the reverse complement of the read.

The next piece of information is this:

No. of allowed errors:
0-7 bp: 0; 8-15 bp: 1; 16-20 bp: 2

The adapter, as was shown above, has a length of 20 characters. We are using a custom error rate of 0.12. What this implies is shown above: Matches up to a length of 7 bp are allowed to have no errors. Matches of lengths 8-15 bp are allowd to have 1 error and matches of length 16 or more can have 2 errors. See also the section about error-tolerant matching.

Finally, a table is output that gives more detailed information about the lengths of the removed sequences. The following is only an excerpt; some rows are left out:

Overview of removed sequences
length  count   expect  max.err error counts
     140     156.2   0       140
     57      39.1    0       57
     50      9.8     0       50
     35      2.4     0       35
     13      0.3     0       1 12
     31      0.1     1       0 31
...
   397     0.0     3       358 36 3

The first row tells us the following: Three bases were removed in 140 reads; randomly, one would expect this to occur 156.2 times; the maximum number of errors at that match length is 0 (this is actually redundant since we know already that no errors are allowed at lengths 0-7 bp).

The last column shows the number of reads that had 0, 1, 2 … errors. In the last row, for example, 358 reads matched the adapter with zero errors, 36 with 1 error, and 3 matched with 2 errors.

In the row for length 7 is an apparent anomaly, where the max.err column is 0 and yet we have 31 reads matching with 1 error. This is because the matches are actually contributed by alignments to the first 8 bases of the adapter with one deletion, so 7 bases are removed but the error cut-off applied is for length 8.

The “expect” column gives only a rough estimate of the number of sequences that is expected to match randomly, but it can help to estimate whether the matches that were found are true adapter matches or if they are due to chance. At lengths 6, for example, only 2.4 reads are expected, but 35 do match, which hints that most of these matches are due to actual adapters. For slightly more accurate estimates, you can provide the correct GC content (as a percentage) of your reads with the option --gc-content. The default is --gc-content=50.

Note that the “length” column refers to the length of the removed sequence. That is, the actual length of the match in the above row at length 100 is 20 since that is the adapter length. Assuming the read length is 100, the adapter was found in the beginning of 397 reads and therefore those reads were trimmed to a length of zero.

The table may also be useful in case the given adapter sequence contains an error. In that case, it may look like this:

...
length  count   expect  max.err error counts
10      53      0.0     1       51 2
11      45      0.0     1       42 3
12      51      0.0     1       48 3
13      39      0.0     1       0 39
14      40      0.0     1       0 40
15      36      0.0     1       0 36
...

We can see that no matches longer than 12 have zero errors. In this case, it indicates that the 13th base of the given adapter sequence is incorrect.

JSON report¶

With --json=filename.cutadapt.json, a report in JSON format is written to the given file.

We strongly recommend that you use the .cutadapt.json file name extension for this file for easier discoverability by log-parsing tools such as MultiQC.

See the description of the JSON report file format.

New in version 3.5.

Info file¶

When the --info-file=info.tsv command-line parameter is given, detailed information about where adapters were found in each read are written to the given text file as tab-separated values.

See the description of the info file format.

User guide¶

Basic usage¶

Input and output file formats¶

Compressed files¶

Standard input and output¶

Multi-core support¶

Speed-up tricks¶

Read processing stages¶

Adapter types¶

Overview of adapter types¶

3’ adapter types¶

5’ adapter types¶

Regular 3’ adapters¶

Regular 5’ adapters¶

Anchored 5’ adapters¶

Anchored 3’ adapters¶

Non-internal 5’ and 3’ adapters¶

Linked adapters (combined 5’ and 3’ adapter)¶

Changing which adapters are required¶

Linked adapter statistics¶

5’ or 3’ adapters¶

Multiple adapter occurrences within a single read¶

Adapter-search parameters¶

Error tolerance¶

N wildcard characters¶

Minimum overlap (reducing random matches)¶

Allowing partial matches at both ends¶

Searching reverse complements¶

Specifying adapter sequences¶

Wildcards¶

Repeated bases¶

Modifying reads¶

--action changes what is done when an adapter is found¶

Removing a fixed number of bases¶

Quality trimming¶

Quality trimming of reads using two-color chemistry (NextSeq)¶

Poly-A trimming¶

Shortening reads to a fixed length¶

Modifying read names¶

--rename renames reads¶

--rename also renames paired-end reads¶

Other read name modifications¶

Filtering reads¶

Trimming paired-end reads¶

Filtering paired-end reads¶

Paired adapters¶

Interleaved paired-end reads¶

Trimming paired-end reads separately¶

Multiple adapters¶

Named adapters¶

Trimming more than one adapter from each read¶

Demultiplexing¶

Demultiplexing paired-end reads with combinatorial dual indexes¶

Demultiplexing unique dual indices¶

Speeding up demultiplexing¶

Demultiplexing paired-end reads in mixed orientation¶

Illumina TruSeq¶

Warning about incomplete adapter sequences¶

Dealing with N bases¶

Cutadapt’s output¶

Reporting¶

How to read the report¶

JSON report¶

Info file¶

`--action` changes what is done when an adapter is found¶

`--rename` renames reads¶

`--rename` also renames paired-end reads¶

Dealing with `N` bases¶