User guide¶
Basic usage¶
To trim a 3’ adapter, the basic command-line for Cutadapt is:
cutadapt -a AACCGGTT -o output.fastq input.fastq
The sequence of the adapter is given with the -a
option. You need to replace
AACCGGTT
with the correct adapter sequence. Reads are read from the input
file input.fastq
and are written to the output file output.fastq
.
Compressed in- and output files are also supported:
cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz
Cutadapt searches for the adapter in all reads and removes it when it finds it. Unless you use a filtering option, all reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed to a length of zero are output. All of this can be changed with command-line options, explained further down.
Trimming of paired-end data is also supported.
Input and output file formats¶
The supported input and output file formats are FASTA and FASTQ, with optional compression.
The input file format is recognized from the file name extension. If the extension was not recognized or when Cutadapt reads from standard input, the contents are inspected instead.
The output file format is also recognized from the file name extension. If the extensions was not recognized or when Cutadapt writes to standard output, the same format as the input is used for the output.
See also file format conversion.
Compressed files¶
Cutadapt supports compressed input and output files. Whether an input file
needs to be decompressed or an output file needs to be compressed is detected
automatically by inspecting the file name: For example, if it ends in .gz
,
then gzip compression is assumed
cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz
All of Cutadapt’s options that expect a file name support this.
The supported compression formats are gzip (.gz
), bzip2 (.bz2
)
and xz (.xz
).
The default compression level for gzip output is 6. Use option -Z
to
change this to level 1. The files need more space, but it is faster and
therefore a good choice for short-lived intermediate files.
If available, Cutadapt uses pigz to speed up writing and reading of gzipped files.
Standard input and output¶
If no output file is specified via the -o
option, then the output is sent to
the standard output stream. Example:
cutadapt -a AACCGGTT input.fastq > output.fastq
There is one difference in behavior if you use Cutadapt without -o
: The
report is sent to the standard error stream instead of standard output. You
can redirect it to a file like this:
cutadapt -a AACCGGTT input.fastq > output.fastq 2> report.txt
Wherever Cutadapt expects a file name, you can also write a dash (-
) in
order to specify that standard input or output should be used. For example:
tail -n 4 input.fastq | cutadapt -a AACCGGTT - > output.fastq
The tail -n 4
prints out only the last four lines of input.fastq
, which
are then piped into Cutadapt. Thus, Cutadapt will work only on the last read in
the input file.
In most cases, you should probably use -
at most once for an input file and
at most once for an output file, in order not to get mixed output.
For the same reason, you should not use -
for non-interleaved paired-end
data.
You cannot combine -
and gzip compression since Cutadapt needs to know the
file name of the output or input file. if you want to have a gzip-compressed
output file, use -o
with an explicit name.
One last “trick” is to use /dev/null
as an output file name. This special
file discards everything you send into it. If you only want to see the
statistics output, for example, and do not care about the trimmed reads at all,
you could use something like this:
cutadapt -a AACCGGTT -o /dev/null input.fastq
Multi-core support¶
Cutadapt supports parallel processing, that is, it can use multiple CPU cores.
Multi-core is not enabled by default. To enable it, use the option -j N
(or the spelled-out version --cores=N
), where N
is the
number of cores to use.
To automatically detect the number of available cores, use -j 0
(or --cores=0
). The detection takes into account resource restrictions
that may be in place. For example, if running Cutadapt as a batch job on a
cluster system, the actual number of cores assigned to the job will be used.
(This works if the cluster systems uses the cpuset(1) mechanism to impose
the resource limitation.)
Make also sure that you have pigz
(parallel gzip) installed if you use
multiple cores and write to a .gz
output file. Otherwise, compression of
the output will be done in a single thread and therefore be a bottleneck.
New in version 1.15.
New in version 1.18: --cores=0
for autodetection
New in version 2.5: Multicore works with --untrimmed/too-short/too-long-(paired)-output
New in version 2.7: Multicore works with --info-file
, --rest-file
, --wildcard-file
New in version 3.0: Multicore support for demultiplexing added.
Speed-up tricks¶
There are several tricks for limiting wall-clock time while using Cutadapt.
-Z
(equivalent to --compression-level=1
) can be used to limit the
amount of CPU time which is spent on the compression of output files.
Alternatively, choosing filenames not ending with .gz
, .bz2
or .xz
will make sure no CPU time is spent on compression at all. On systems
with slow I/O, it can actually be faster to set a higher compression-level
than 1.
Increasing the number of cores with -j
will increase the number of reads per
minute at near-linear rate.
It is also possible to use pipes in order to bypass the filesystem and pipe
cutadapt’s output into an aligner such as BWA. The mkfifo
command allows
you to create named pipes in bash.
This command will run cutadapt and BWA simultaneously, using Cutadapt’s output as
BWA’s input, and capturing Cutadapt’s report in cutadapt.report
.
Read processing stages¶
Cutadapt can do a lot more in addition to removing adapters. There are various command-line options that make it possible to modify and filter reads and to redirect them to various output files. Each read is processed in the following order:
- Read modification options are applied. This includes
adapter removal,
quality trimming, read name modifications etc. The
order in which they are applied is the order in which they are listed in the
help shown by
cutadapt --help
under the “Additional read modifications” heading. Adapter trimming itself does not appear in that list and is done after quality trimming and before length trimming (--length
/-l
). - Filtering options are applied, such as removal of too
short or untrimmed reads. Some of the filters also allow to redirect a read
to a separate output file. The filters are applied in the order in which
they are listed in the help shown by
cutadapt --help
under the “Filtering of processed reads” heading. - If the read has passed all the filters, it is written to the output file.
Adapter types¶
Cutadapt can detect multiple adapter types. 5’ adapters preceed the sequence of interest and 3’ adapters follow it. Further distinctions are made according to where in the read the adapter sequence is allowed to occur.
Adapter type | Command-line option |
---|---|
Regular 3’ adapter | -a ADAPTER |
Regular 5’ adapter | -g ADAPTER |
Non-internal 3’ adapter | -a ADAPTERX |
Non-internal 5’ adapter | -g XADAPTER |
Anchored 3’ adapter | -a ADAPTER$ |
Anchored 5’ adapter | -g ^ADAPTER |
5’ or 3’ (both possible) | -b ADAPTER |
Linked adapter | -a ^ADAPTER1...ADAPTER2 -g ADAPTER1...ADAPTER2 |
By default, all adapters are searched error-tolerantly.
Adapter sequences may also contain any IUPAC wildcard
character (such as N
).
In addition, it is possible to remove a fixed number of bases from the beginning or end of each read, to remove low-quality bases (quality trimming) from the 3’ and 5’ ends, and to search for adapters also in the reverse-complemented reads.
Overview of adapter types¶
3’ adapter types¶
A 3’ adapter is assumed to be ligated to the 3’ end of your sequence of interest. When such an adapter is found, the adapter sequence itself and the sequence following it (if there is any) are trimmed. This table shows in which ways the different 3’ adapter types are allowed to occur in a read in order to be recognized by the program.
Adapter location in read | Read layout | Found by regular 3’
-a ADAPTER |
Found by non-internal 3’
-a ADAPTERX |
Found by anchored 3’
-a ADAPTER$ |
---|---|---|---|---|
Full adapter sequence anywhere | acgtacgtADAPTERacgt | yes | no | no |
Partial adapter sequence at 3’ end | acgtacgtacgtADAP | yes | yes | no |
Full adapter sequence at 3’ end | acgtacgtacgtADAPTER | yes | yes | yes |
5’ adapter types¶
A 5’ adapter is assumed to be ligated to the 5’ end of your sequence of interest. When such an adapter is found, the adapter sequence itself and the sequence preceding it (if there is any) are trimmed. This table shows in which ways the different 5’ adapter types are allowed to occur in a read in order to be recognized by the program.
Adapter location in read | Read layout | Found by regular 5’
-g ADAPTER |
Found by non-internal 5’
-g XADAPTER |
Found by anchored 5’
-g ^ADAPTER |
---|---|---|---|---|
Full adapter sequence anywhere | acgtADAPTERacgtacgt | yes | no | no |
Partial adapter sequence at 5’ end | PTERacgtacgtacgt | yes | yes | no |
Full adapter sequence at 5’ end | ADAPTERacgtacgtacgt | yes | yes | yes |
Regular 3’ adapters¶
A 3’ adapter is a piece of DNA ligated to the 3’ end of the DNA fragment you are interested in. The sequencer starts the sequencing process at the 5’ end of the fragment and sequences into the adapter if the read is long enough. The read that it outputs will then have a part of the adapter in the end. Or, if the adapter was short and the read length quite long, then the adapter will be somewhere within the read, followed by some other bases.
For example, assume your fragment of interest is mysequence and the adapter is ADAPTER. Depending on the read length, you will get reads that look like this:
mysequen
mysequenceADAP
mysequenceADAPTER
mysequenceADAPTERsomethingelse
Use Cutadapt’s -a ADAPTER
option to remove this type of adapter. This will
be the result:
mysequen
mysequence
mysequence
mysequence
As this example shows, Cutadapt allows regular 3’ adapters to occur in full anywhere within the read (preceeded and/or succeeded by zero or more bases), and also partially degraded at the 3’ end. Cutadapt deals with 3’ adapters by removing the adapter itself and any sequence that may follow. As a consequence, a sequence that starts with an adapter, like this, will be trimmed to an empty read:
ADAPTERsomething
By default, empty reads are kept and will appear in the output. If you do not
want this, use the --minimum-length
/-m
filtering option.
Regular 5’ adapters¶
Note
Unless your adapter may also occur in a degraded form, you probably want to use an anchored 5’ adapter.
A 5’ adapter is a piece of DNA ligated to the 5’ end of the DNA fragment of interest. For this type of adapter to be found, the adapter sequence needs to either appear in full somewhere within the read (internal match) or at the start (5’ end) of it, where in the latter case also partial occurrences are allowed. In all cases, the adapter itself and the sequence preceding it is removed.
Assume your fragment of interest is mysequence and the adapter is ADAPTER. The reads may look like this:
ADAPTERmysequence
DAPTERmysequence
TERmysequence
somethingADAPTERmysequence
All the above sequences are trimmed to mysequence
when you use -g ADAPTER.
As with 3’ adapters, the resulting read may have a length of zero when the
sequence ends with the adapter. For example, the read
somethingADAPTER
will be empty after trimming.
Anchored 5’ adapters¶
In many cases, the above behavior is not really what you want for trimming 5’ adapters. You may know, for example, that degradation does not occur and that the adapter is also not expected to be within the read. Thus, you always expect the read to look like the first example from above:
ADAPTERsomething
If you want to trim only this type of adapter, use -g ^ADAPTER
. The ^
is
supposed to indicate the the adapter is “anchored” at the beginning of the read.
In other words: The adapter is expected to be a prefix of the read. Note that
cases like these are also recognized:
ADAPTER
ADAPT
ADA
The read will simply be empty after trimming.
Be aware that Cutadapt still searches for adapters error-tolerantly and, in particular, allows insertions. So if your maximum error rate is sufficiently high, even this read will be trimmed:
BADAPTERsomething
The B
in the beginning is seen as an insertion. If you also want to prevent
this from happening, use the option --no-indels
to disallow insertions and
deletions entirely.
Anchored 3’ adapters¶
It is also possible to anchor 3’ adapters to the end of the read. This is
rarely necessary, but if you have merged, for example, overlapping paired-end
reads, then it is useful. Add the $
character to the end of an
adapter sequence specified via -a
in order to anchor the adapter to the
end of the read, such as -a ADAPTER$
. The adapter will only be found if it
is a suffix of the read, but errors are still allowed as for 5’ adapters.
You can disable insertions and deletions with --no-indels
.
Anchored 3’ adapters work as if you had reversed the sequence and used an appropriate anchored 5’ adapter.
As an example, assume you have these reads:
mysequenceADAP
mysequenceADAPTER
mysequenceADAPTERsomethingelse
Using -a ADAPTER$
will result in:
mysequenceADAP
mysequence
mysequenceADAPTERsomethingelse
That is, only the middle read is trimmed at all.
Non-internal 5’ and 3’ adapters¶
The non-internal 5’ and 3’ adapter types disallow internal occurrences of the adapter sequence. This is like a less strict version of anchoring: The adapter must always be at one of the ends of the read, but - unlike anchored adapters - partial occurrences are also ok.
Use -a ADAPTERX
(replace ADAPTER
with your actual adapter sequence, but
use a literal X
) to disallow internal matches for a 3’ adapter. Use
-g XADAPTER
to disallow them for a 5’ adapter.
Mnemonic: The X
is not allowed to “shift into” the read.
Here are some examples for trimming reads with -a ADAPTERX
:
Input read | Processed read |
---|---|
mysequenceADAP |
mysequence |
mysequenceADAPTER |
mysequence |
mysequenceADAPTERsomethingelse |
mysequenceADAPTERsomethingelse |
Here are some examples for trimming reads with -g XADAPTER
:
Input read | Processed read |
---|---|
APTERmysequence |
mysequence |
ADAPTERmysequence |
mysequence |
somethingelseADAPTERmysequence |
somethingelseADAPTERmysequence |
New in version 1.17.
Linked adapters (combined 5’ and 3’ adapter)¶
If your sequence of interest is “framed” by a 5’ and a 3’ adapter, and you want
to remove both adapters, then you may want to use a linked adapter. A linked
adapter combines a 5’ and a 3’ adapter. By default, the adapters are not anchored,
but in many cases, you should anchor the 5’ adapter by prefixing it with ^
.
See the previous sections for what anchoring means.
Note
Cutadapt versions before 2.0 anchored the 5’ adapter within linked adapters
automatically even if the initial ^
was not specified. If you have scripts
written for Cutadapt versions earlier than 2.0, please add the ^
so that
the behavior does not change!
Linked adapters are specified as two sequences separated by ...
(three dots):
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fastq.gz in.fastq.gz
If you anchor an adapter, it will also become marked as being required. If a required adapter cannot be found, the read will not be trimmed at all even if the other adapter occurs. If an adapter is not required, it is optional.
Also, when you use the --discard-untrimmed
option (or --trimmed-only
) with a
linked adapter, then a read is considered to be trimmed only if all required adapters
were found.
In the previous example, ADAPTER1
was anchored and therefore required, but ADAPTER2
was optional. Anchoring also ADAPTER2
(and making it required as well) would look like this:
cutadapt -a ^ADAPTER1...ADAPTER2$ -o out.fastq.gz in.fastq.gz
As an example, assume the 5’ adapter is FIRST, the 3’ adapter is SECOND and you have these input reads:
FIRSTmysequenceSECONDextrabases
FIRSTmysequenceSEC
FIRSTmyseque
anotherreadSECOND
Trimming with
cutadapt -a ^FIRST...SECOND -o output.fastq input.fastq
will result in
mysequence
mysequence
myseque
anotherreadSECOND
The 3’ adapter in the last read is not trimmed because the anchored 5’ adapter is required, but missing in the read.
Linked adapters do not work when used in combination with --info-file
and --mask-adapter
.
New in version 1.10.
New in version 1.13: Ability to anchor the 3’ adapter.
New in version 2.0: The 5’ adapter is no longer anchored by default.
Changing which adapters are required¶
As described, when you specify a linked adapter with -a
, the adapters that are anchored
become required, and the non-anchored adapters become optional. To change this, you can
instead use -g
to specify a linked adapter. In that case, both adapters are required
(even if they are not anchored). This type of linked adapter type is especially suited for
trimming CRISPR screening reads. For example:
cutadapt -g ADAPTER1...ADAPTER2 -o out.fastq.gz in.fastq.gz
Here, both ADAPTER1
and ADAPTER2
are not anchored, but they are required because -g
was used.
The -g
option does not cover all cases, so you can also mark each adapter explicitly as
required or optional using the trimming parameters
required
and optional
. This is the only way to make an anchored adapter optional.
For example, to request that an anchored 5’ adapter (here ADAPTER1
) should not be required,
you can specify it like this
cutadapt -a "^ADAPTER1;optional...ADAPTER2" -o output.fastq.gz input.fastq.gz
New in version 1.13: Option -g
added.
Changed in version 1.15: Option -g
requires both adapters.
Linked adapter statistics¶
For linked adapters, the statistics report contains a line like this:
=== Adapter 1 ===
Sequence: AAAAAAAAA...TTTTTTTTTT; Type: linked; Length: 9+10; Trimmed: 3 times; Half matches: 2
The value for “Half matches” tells you how often only the 5’-side of the adapter was found, but not the 3’-side of it. This applies only to linked adapters with regular (non-anchored) 3’ adapters.
5’ or 3’ adapters¶
The last type of adapter is a combination of the 5’ and 3’ adapter. You can use it when your adapter is ligated to the 5’ end for some reads and to the 3’ end in other reads. This probably does not happen very often, and this adapter type was in fact originally implemented because the library preparation in an experiment did not work as it was supposed to.
For this type of adapter, the sequence is specified with -b ADAPTER
(or use
the longer spelling --anywhere ADAPTER
). The adapter may appear in the
beginning (even degraded), within the read, or at the end of the read (even
partially). The decision which part of the read to remove is made as follows: If
there is at least one base before the found adapter, then the adapter is
considered to be a 3’ adapter and the adapter itself and everything
following it is removed. Otherwise, the adapter is considered to be a 5’
adapter and it is removed from the read, but the sequence after it remains.
Here are some examples.
Read before trimming | Read after trimming | Detected adapter type |
---|---|---|
MYSEQUENCEADAPTERSOMETHING |
MYSEQUENCE |
3’ adapter |
MYSEQUENCEADAPTER |
MYSEQUENCE |
3’ adapter |
MYSEQUENCEADAP |
MYSEQUENCE |
3’ adapter |
MADAPTER |
M |
3’ adapter |
ADAPTERMYSEQUENCE |
MYSEQUENCE |
5’ adapter |
PTERMYSEQUENCE |
MYSEQUENCE |
5’ adapter |
TERMYSEQUENCE |
MYSEQUENCE |
5’ adapter |
Multiple adapter occurrences within a single read¶
If a single read contains multiple copies of the same adapter, the basic rule is that the leftmost match is used for both 5’ and 3’ adapters. For example, when searching for a 3’ adapter in
cccccADAPTERgggggADAPTERttttt
the read will be trimmed to
ccccc
When the adapter is a 5’ adapter instead, the read will be trimmed to
gggggADAPTERttttt
Adapter-trimming parameters¶
The adapter-trimming algorithm has a few parameters specific to each adapter
that steer how the adapter sequence is found. The command-line options -e
and -O
set the maximum error rate and minimum overlap parameters (see
details in the following sections) for all
adapters listed via the -a
/-b
/-g
etc. options. When trimming more
than one adapter, it may be necessary to change parameters for each
adapter individually. You can do so by adding a semicolon and parameter=value
to the end
of the adapter sequence, as in -a "ADAPTER;max_error_rate=0.2"
.
Multiple parameters can also be set, as in -a "ADAPTER;max_error_rate=0.2;min_overlap=5"
.
Remember to add the quotation marks; otherwise the shell will interpret the semicolon as a
separator between two commands.
The following parameters are supported at the moment:
Parameter | Global option | Adapter-specific parameter |
---|---|---|
Maximum error rate | -e 0.2 |
ADAPTER;e=0.2 orADAPTER;max_errors=0.2 orADAPTER;max_error_rate=0.2 |
Minimum overlap | -O 5 |
ADAPTER;o=5 orADAPTER;min_overlap=5 |
Allow matches anywhere | ADAPTER;anywhere |
|
Linked adapter required | ADAPTER;required |
|
Linked adapter optional | ADAPTER;optional |
Adapter-specific parameters override the global option.
Error tolerance¶
All searches for adapter sequences are error tolerant. Allowed errors are
mismatches, insertions and deletions. For example, if you search for the
adapter sequence ADAPTER
and the error tolerance is set appropriately
(as explained below), then also ADABTER
will be found (with 1 mismatch),
as well as ADAPTR
(with 1 deletion), and also ADAPPTER
(with 1
insertion). If insertions and deletions are disabled with --no-indels
,
then mismatches are the only type of errors.
The level of error tolerance is determined by a maximum error rate, which is 0.1 (=10%) by default. An adapter occurrence is only found if the actual error rate of the match does not exceed the maximum error rate. The actual error rate is computed as the number of errors in the match divided by the length of the matching part of the adapter.
For example, an adapter match of length 8 containing 1 error has an error rate of 1/8=0.125. At the default maximum error rate 0.1, it would not be found, but a match of length 10 containing 1 error has an error rate of 1/10=0.1 and would be found.
Relating the number of errros to the length of the matching part of the adapter is important because Cutadapt allows for partial adapter occurrences (for the non-anchored adapter types). If only the absolute number of errors were used, shorter matches would be favored unfairly. For example, assume an adapter has 30 bases and we allow three errors over that length. If we allowed these three errors even for a partial occurrences of, for example, four bases, we can immediately see that this results in unexpected matches. Using the error rate as a criterion helps to keep sensitivity and specificity roughly the same over the possible lengths of the matches.
The -e
option on the command line allows you to change the maximum error rate.
If the value is between 0 and 1 (but not 1 exactly), then this sets the maximum
error rate directly for all specified adapters. The default is -e 0.1
. You
can also use the adapter-specific parameter max_error_rate
or max_errors
or just e
to override the default for a single adapter only.
Examples: -a "ADAPTER;max_error_rate=0.15"
, -a "ADAPTER;e=0.15"
(the quotation marks are necessary).
Alternatively, you can also specify a value of 1 or greater as the number of
allowed errors, which is then converted to a maximum error rate for each adapter
individually. For example, with an adapter of length 10, using -e 2
will
set the maximum error rate to 0.2 for an adapter of length 10.
The value does not have to be an integer, and if you use an adapter type
that allows partial matches, you may want to add 0.5 to the desired number of
errors, which achieves that even slightly shorter than full-lengths
matches will be allowed at the specified number of errors. In short, if you
want to allow two errors, use -e 2.5
.
This also works in the adapter-specific parameters.
Examples: -a "ADAPTER;e=1"
, -a "ADAPTER;max_errors=2.5"
. Note that
e
, max_error_rate
and max_errors
are all equivalent and the
decision whether a rate or an absolute number is meant is based on
whether the given value is less than 1 or not.
The number of errors allowed for a given adapter match length is also shown under the “No. of allowed errors” heading in the report that Cutadapt prints:
Sequence: 'SOMEADAPTER'; Length: 11; Trimmed: 2 times.
No. of allowed errors:
0-9 bp: 0; 10-11 bp: 1
This tells us: For match lengths of 0-9 bases, zero errors are allowed and for matches of length 10-11 bases, one error is allowed.
See also the section on details of the alignment algorithm.
N wildcard characters¶
Any N
wildcard characters in the adapter sequence are skipped when
computing the error rate. That is, they do not contribute to the length of
a match. For example, the adapter sequence ACGTACNNNNNNNNGTACGT
has a length
of 20, but only 12 non-N
-characters. At a maximum error rate of 0.1, only
one error is allowed if this sequence is found in full in a read because
12·0.1=1.2, which is 1 when rounded down.
This is done because N
bases cannot contribute to the number of errors.
In previous versions, N
wildcard characters did contribute to the match
length, but this artificially inflates the number of allowed errors. For example,
an adapter like N{18}CC
(18 N
wildcards followed by CC
) would
effectively match anywhere because the default error rate of 0.1 would allow for
two errors, but there are only two non-N
bases in the particular adapter.
However, even in previous versions, the location with the greatest number of matching bases is chosen as the best location for an adapter, so in many cases the adapter would still be placed properly.
Minimum overlap (reducing random matches)¶
Since Cutadapt allows partial matches between the read and the adapter sequence, short matches can occur by chance, leading to erroneously trimmed bases. For example, roughly 25% of all reads end with a base that is identical to the first base of the adapter. To reduce the number of falsely trimmed bases, the alignment algorithm requires that, by default, at least three bases match between adapter and read.
This minimum overlap length can be changed globally (for all adapters) with the parameter
--overlap
(or its short version -O
). Alternatively, use the adapter-specific
parameter min_overlap
to change it for a single adapter only. Example:
-a "ADAPTER;min_overlap=5"
(the quotation marks are necessary).
If a read contains a partial adapter sequence shorter than the minimum overlap length, no match will be found (and therefore no bases are trimmed).
Requiring at least three bases to match is quite conservative. Even if no minimum overlap was required, we can compute that we lose only about 0.44 bases per read on average, see Section 2.3.3 in my thesis. With the default minimum overlap length of 3, only about 0.07 bases are lost per read.
When choosing an appropriate minimum overlap length, take into account that true adapter matches are also lost when the overlap length is higher than zero, reducing Cutadapt’s sensitivity.
Allowing partial matches at both ends¶
The regular 5’ and 3’ adapter types allow partial adapter occurrences only
at the 5’ and 3’ end, respectively. To allow partial matches at both ends,
you can use the anywhere
adapter-specific parameter.
A 3’ adapter specified via -a ADAPTER
will be found even
when it occurs partially at the 3’ end, as in mysequenceADAPT
. However,
it will by default not be found if it occurs partially at the 5’ end, as in
APTERmysequence
. To find the adapter in both cases, specify
the adapter as -a "ADAPTER;anywhere"
.
Similarly, for a 5’ adapter specified via -g ADAPTER
, partial matches at
the 3’ end are not found, as in mysequenceADAPT
. To allow partial matches
at both ends, use -g "ADAPTER;anywhere"
.
Note
With anywhere
, partial matches at the end that is usually not allowed
to be matched will result in empty reads! This means that short random
matches have a much greater detrimental effect and you should
increase the minimum overlap length.
Searching reverse complements¶
Note
Option --revcomp
is added on a tentative basis. Its behaviour may change in the next
releases.
By default, Cutadapt expects adapters to be given in the same orientation (5’ to 3’) as the reads. That is, neither reads nor adapters are reverse-complemented.
To change this, use option --revcomp
or its abbreviation --rc
. If given, Cutadapt searches
both the read and its reverse complement for adapters. If the reverse complemented read yields
a better match, then that version of the read is kept. That is, the output file will contain the
reverse-complemented sequence. This can be used to “normalize” read orientation/strandedness.
To determine which version of the read yields the better match, the full adapter search (possibly
multiple rounds if --times
is used) is done independently on both versions, and the version that
results in the higher number of matching nucleotides is considered to be the better one.
The name of a reverse-complemented read is changed by adding a space and rc
to it. (Please
file an issue if you would like this to be configurable.)
The report will show the number of reads that were reverse-complemented, like this:
Total reads processed: 60
Reads with adapters: 50 (83.3%)
Reverse-complemented: 20 (33.3%)
Here, 20 reverse-complemented reads contain an adapter and 50 - 20 = 30 reads that did not need to be reverse-complemented contain an adapter.
Option --revcomp
is currently available only for single-end data.
New in version 2.8.
Specifying adapter sequences¶
Wildcards¶
All IUPAC nucleotide codes
(wildcard characters) are supported. For example, use an N
in the adapter
sequence to match any nucleotide in the read, or use -a YACGT
for an adapter
that matches both CACGT
and TACGT
. The wildcard character N
is
useful for trimming adapters with an embedded variable barcode:
cutadapt -a ACGTAANNNNTTAGC -o output.fastq input.fastq
Even the X
wildcard that does not match any nucleotide is supported. If
used as in -a ADAPTERX
or -g XADAPTER
, it acquires a special meaning for
and disallows internal adapter matches.
Wildcard characters are by default only allowed in adapter sequences and
are not recognized when they occur in a read. This is to avoid matches in reads
that consist of many (often low-quality) N
bases. Use
--match-read-wildcards
to enable wildcards also in reads.
Use the option -N
to disable interpretation of wildcard characters even in
the adapters. If wildcards are disabled entirely, that is, when you use -N
and do not use --match-read-wildcards
, then Cutadapt compares characters
by their ASCII value. Thus, both the read and adapter can be arbitrary strings
(such as SEQUENCE
or ADAPTER
as used here in the examples).
Repeated bases¶
If you have many repeated bases in the adapter sequence, such as many N
s or
many A
s, you do not have to spell them out. For example, instead of writing
ten A
in a row (AAAAAAAAAA
), write A{10}
instead. The number within
the curly braces specifies how often the character that preceeds it will be
repeated. This works also for IUPAC wildcard characters, as in N{5}
.
It is recommended that you use quotation marks around your adapter sequence if you use this feature. For poly-A trimming, for example, you would write:
cutadapt -a "A{100}" -o output.fastq input.fastq
Modifying reads¶
This section describes in which ways reads can be modified other than adapter removal.
Not trimming adapters¶
Instead of removing an adapter from a read, it is also possible to take other
actions when an adapter is found by specifying the --action
option.
The default is --action=trim
, which will remove the adapter and either
the sequence before or after it from the read.
Use --action=none
to not remove the adapter from the read. This is useful
when combined with other options, such as --untrimmed-output
, which
will redirect the reads without adapter to a different file. Other read
modification options (as listed below) may still change the read.
Use --action=mask
to write N
characters to that parts of the read
that would otherwise have been removed .
Use --action=lowercase
to change to lowercase that part of the read that would otherwise
have been removed. The rest is converted to uppercase.
Removing a fixed number of bases¶
By using the --cut
option or its abbreviation -u
, it is possible to
unconditionally remove bases from the beginning or end of each read. If
the given length is positive, the bases are removed from the beginning
of each read. If it is negative, the bases are removed from the end.
For example, to remove the first five bases of each read:
cutadapt -u 5 -o trimmed.fastq reads.fastq
To remove the last seven bases of each read:
cutadapt -u -7 -o trimmed.fastq reads.fastq
The -u
/--cut
option can be combined with the other options, but
the --cut
is applied before any adapter trimming.
Quality trimming¶
The -q
(or --quality-cutoff
) parameter can be used to trim
low-quality ends from reads. If you specify a single cutoff value, the
3’ end of each read is trimmed:
cutadapt -q 10 -o output.fastq input.fastq
For Illumina reads, this is sufficient as their quality is high at the beginning, but degrades towards the 3’ end.
It is also possible to also trim from the 5’ end by specifying two comma-separated cutoffs as 5’ cutoff,3’ cutoff. For example,
cutadapt -q 15,10 -o output.fastq input.fastq
will quality-trim the 5’ end with a cutoff of 15 and the 3’ end with a cutoff
of 10. To only trim the 5’ end, use a cutoff of 0 for the 3’ end, as in
-q 15,0
.
Quality trimming is done before any adapter trimming.
By default, quality values are assumed to be encoded as
ascii(phred quality + 33). Nowadays, this should always be the case.
Some old Illumina FASTQ files encode qualities as ascii(phred quality + 64).
For those, you must add --quality-base=64
to the command line.
A description of the quality-trimming algorithm is also available. The algorithm is the same as used by BWA.
Quality trimming of reads using two-color chemistry (NextSeq)¶
Some Illumina instruments use a two-color chemistry to encode the four bases.
This includes the NextSeq and the NovaSeq. In those instruments, a
‘dark cycle’ (with no detected color)
encodes a G
. However, dark cycles also occur when sequencing “falls
off” the end of the fragment. The read then contains a run of high-quality, but
incorrect “G” calls
at its 3’ end.
Since the regular quality-trimming algorithm cannot deal with this situation,
you need to use the --nextseq-trim
option:
cutadapt --nextseq-trim=20 -o out.fastq input.fastq
This works like regular quality trimming (where one would use -q 20
instead), except that the qualities of G
bases are ignored.
New in version 1.10.
Shortening reads to a fixed length¶
To shorten each read down to a certain length, use the --length
option or
the short version -l
:
cutadapt -l 10 -o output.fastq.gz input.fastq.gz
This shortens all reads from input.fastq.gz
down to 10 bases. The removed bases
are those on the 3’ end.
If you want to remove a fixed number of bases from each read, use the –cut option instead.
Modifying read names¶
If you feel the need to modify the names of processed reads, some of the following options may be useful.
Use -y
or --suffix
to append a text to read names. The given string can
contain the placeholder {name}
, which will be replaced with the name of the
adapter found in that read. For example, writing
cutadapt -a adapter1=ACGT -y ' we found {name}' input.fastq
changes a read named read1
to read1 we found adapter1
if the adapter
ACGT
was found. The options -x
/--prefix
work the same, but the text
is added in front of the read name. For both options, spaces need to be
specified explicitly, as in the above example. If no adapter was found in a
read, the text no_adapter
is inserted for {name}
.
In order to remove a suffix of each read name, use --strip-suffix
.
Some old 454 read files contain the length of the read in the name:
>read1 length=17
ACGTACGTACAAAAAAA
If you want to update this to the correct length after trimming, use the option
--length-tag
. In this example, this would be --length-tag 'length='
.
After trimming, the read would perhaps look like this:
>read1 length=10
ACGTACGTAC
Read modification order¶
The read modifications described above are applied in the following order to each read. Steps not requested on the command-line are skipped.
- Unconditional base removal with
--cut
- Quality trimming (
-q
) - Adapter trimming (
-a
,-b
,-g
and uppercase versions) - Read shortening (
--length
) - N-end trimming (
--trim-n
) - Length tag modification (
--length-tag
) - Read name suffix removal (
--strip-suffix
) - Addition of prefix and suffix to read name (
-x
/--prefix
and-y
/--suffix
) - Replace negative quality values with zero (zero capping)
Filtering reads¶
By default, all processed reads, no matter whether they were trimmed or not,
are written to the output file specified by the -o
option (or to standard
output if -o
was not provided). For paired-end reads, the second read in a
pair is always written to the file specified by the -p
option.
The options described here make it possible to filter reads by either discarding them entirely or by redirecting them to other files. When redirecting reads, the basic rule is that each read is written to at most one file. You cannot write reads to more than one output file.
Filters are applied to all processed reads, no matter whether they have been modified by adapter- or quality trimming.
--minimum-length LENGTH
or-m LENGTH
Discard processed reads that are shorter than LENGTH.
If you do not use this option, reads that have a length of zero (empty reads) are kept in the output. Some downstream tools may have problems with zero-length sequences. In that case, specify at least
-m 1
.--too-short-output FILE
- Instead of discarding the reads that are too short according to
-m
, write them to FILE (in FASTA/FASTQ format). --maximum-length LENGTH
or-M LENGTH
- Discard processed reads that are longer than LENGTH.
--too-long-output FILE
- Instead of discarding reads that are too long (according to
-M
), write them to FILE (in FASTA/FASTQ format). --untrimmed-output FILE
- Write all reads without adapters to FILE (in FASTA/FASTQ format) instead of writing them to the regular output file.
--discard-trimmed
- Discard reads in which an adapter was found.
--discard-untrimmed
- Discard reads in which no adapter was found. This has the same effect as
specifying
--untrimmed-output /dev/null
.
The options --too-short-output
and --too-long-output
are applied first.
This means, for example, that a read that is too long will never end up in the
--untrimmed-output
file when --too-long-output
was given, no matter
whether it was trimmed or not.
The options --untrimmed-output
, --discard-trimmed
and -discard-untrimmed
are mutually exclusive.
The following filtering options do not have a corresponding option for redirecting reads. They always discard those reads for which the filtering criterion applies.
--max-n COUNT_or_FRACTION
- Discard reads with more than COUNT
N
bases. IfCOUNT_or_FRACTION
is a number between 0 and 1, it is interpreted as a fraction of the read length --max-expected-errors ERRORS
or--max-ee ERRORS
- Discard reads with more than ERRORS expected errors. The number of expected errors is computed as described in Edgar et al. (2015), (Section 2.2).
--discard-casava
- Discard reads that did not pass CASAVA filtering. Illumina’s CASAVA pipeline in
version 1.8 adds an is_filtered header field to each read. Specifying this
option, the reads that did not pass filtering (these are the reads that have
a
Y
for is_filtered) will be discarded. Reads for which the header cannot be recognized are kept.
Trimming paired-end reads¶
Cutadapt supports trimming of paired-end reads. To enable this, provide two
input files and a second output file with the -p
option (this is the short
form of --paired-output
). This is the basic command line syntax:
cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq
Here, the input reads are in reads.1.fastq
and reads.2.fastq
, and the
result will be written to out.1.fastq
and out.2.fastq
.
In paired-end mode, the options -a
, -b
, -g
and -u
that also
exist in single-end mode are applied to the forward reads only. To modify
the reverse read, these options have uppercase versions -A
, -B
,
-G
and -U
that work just like their counterparts.
In the example above, ADAPTER_FWD
will therefore be trimmed from the
forward reads and ADAPTER_REV
from the reverse reads.
Single-end/R1 option | Corresponding option for R2 |
---|---|
--adapter , -a |
-A |
--front , -g |
-G |
--anywhere , -b |
-B |
--cut , -u |
-U |
--output , -o |
--paired-output , -p |
In paired-end mode, Cutadapt checks whether the input files are
properly paired. An error is raised if one of the files contains more reads than
the other or if the read names in the two files do not match. The read name
comparison ignores a trailing /1
or /2
to allow processing some old
Illumina paired-end files.
In some cases, it works to run Cutadapt twice in single-end mode on the input files, but we recommend against it as this skips the consistency checks that Cutadapt can do otherwise.
Also, as soon as you start to use one of the filtering options that discard reads, it is mandatory you process both files at the same time to make sure that the output files are kept synchronized. If a read is removed from one of the files, Cutadapt will always ensure that it is also removed from the other file.
The following command-line options are applied to both reads:
-q
(along with--quality-base
)--times
applies to all the adapters given--trim-n
--action
--length
--length-tag
--prefix
,--suffix
The following limitations still exist:
- The
--info-file
,--rest-file
and--wildcard-file
options write out information only from the first read.
Filtering paired-end reads¶
The filtering options listed above can also be used when trimming paired-end data.
Importantly, Cutadapt always discards both reads of a pair if it determines that the pair should be discarded. This ensures that the reads in the output files are in sync. (If you don’t want or need this, you can run Cutadapt separately on the R1 and R2 files.)
The same applies also to the options that redirect reads to other files if they
fulfill a filtering criterion, such as
--too-short-output
/--too-short-paired-output
. That is, the reads are
always sent in pairs to these alternative output files.
The --pair-filter
option determines how to combine the filters for
R1 and R2 into a single decision about the read pair.
The default is --pair-filter=any
, which means that a read pair is discarded
(or redirected) if one of the reads (R1 or R2) fulfills the filtering criterion.
As an example, if option --minimum-length=20
is used and paired-end data is
processed, a read pair is discarded if at least one of the reads is shorter than
20 nt.
With --pair-filter=both
, you can require that filtering criteria must apply
to both reads in order for a read pair to be discarded.
Finally, --pair-filter=first
will make a decision about the read pair
by inspecting whether the filtering criterion applies to the first read,
ignoring the second read.
The following table describes the effect for some filtering options.
Filtering option | With --pair-filter=any , the pair
is discarded if … |
With --pair-filter=both , the pair
is discarded if … |
---|---|---|
--minimum-length |
one of the reads is too short | both reads are too short |
--maximum-length |
one of the reads is too long | both reads are too long |
--discard-trimmed |
one of the reads contains an adapter | both reads contain an adapter |
--discard-untrimmed |
one of the reads does not contain an adapter | both reads do not contain an adapter |
--max-n |
one of the reads contains too many N bases |
both reads contain too many N bases |
Note
As an exception, when you specify adapters only for R1 (-a
/-g
/-b
) or only for
R2 (-A
/-G
/-B
), then the --pair-filter
mode for --discard-untrimmed
is
forced to be both
(and accordingly, also for the --untrimmed-(paired-)output
options).
Otherwise, with the default --pair-filter=any
setting, all pairs would be considered
untrimmed because it would always be the case that one of the reads in the pair does not contain
an adapter.
These are the paired-end specific filtering and output options:
--minimum-length LENGTH1:LENGTH2
or-m LENGTH1:LENGTH2
- When trimming paired-end reads, the minimum lengths for R1 and R2 can be specified
separately by separating them with a colon (
:
). If the colon syntax is not used, the same minimum length applies to both reads, as discussed above. Also, one of the values can be omitted to impose no restrictions. For example, with-m 17:
, the length of R1 must be at least 17, but the length of R2 is ignored. --maximum-length LENGTH1:LENGTH2
or-M LENGTH1:LENGTH2
- Maximum lengths can also be specified separately, see the explanation of
-m
above. --paired-output FILE
or-p FILE
- Write the second read of each processed pair to FILE (in FASTA/FASTQ format).
--untrimmed-paired-output FILE
- Used together with
--untrimmed-output
. The second read in a pair is written to this file when the processed pair was not trimmed. --too-short-paired-output FILE
- Write the second read in a pair to this file if pair is too short. Use
together with
--too-short-output
. --too-long-paired-output FILE
- Write the second read in a pair to this file if pair is too long. Use
together with
--too-long-output
. --pair-filter=(any|both|first)
- Which of the reads in a paired-end read have to match the filtering criterion in order for it to be filtered.
Note that the option names can be abbreviated as long as it is clear which
option is meant (unique prefix). For example, instead of --untrimmed-output
and --untrimmed-paired-output
, you can write --untrimmed-o
and
--untrimmed-p
.
New in version 1.18: --pair-filter=first
Paired adapters (dual indices)¶
Note
This feature has been added on a provisional basis. It may still change. For example, Cutadapt may require that the adapters from the R1 and the R2 sets have matching names, which would allow for better error checking.
When processing paired-end data, Cutadapt has two sets of adapters to work with: The ones that
are to be found and removed in the forward read (R1), specified with -a
/-g
/-b
,
and the ones to be found and removed in the reverse read (R2), specified with -A
/-G
/-B
.
Normally, the program looks at the R1 and R2 reads independently. That is, the best matching R1 adapter is removed from R1 and the best matching R2 adapter is removed from R2.
To change this, the option --pair-adapters
can be used. It causes each R1 adapter to be
paired up with its corresponding R2 adapters. The first R1 adapter will be paired up with the first
R2 adapter, and so on. The adapters are then always removed in pairs from a read pair. It is an
error if the number of provided adapters is not identical for the R1 and R2 sets.
This option was added to aid in demultiplexing Illumina libraries that contain unique dual indexes (UDI). This scheme, also called “non-redundant indexing”, uses 96 unique i5 indices and 96 unique i7 indices, which are only used in pairs, that is, the first i5 index is always used with the first i7 index and so on.
Note
If the adapters do not come in pairs, but all combinations are possible, see the section about combinatorial demultiplexing.
An example:
cutadapt --pair-adapters -a AAAAA -a GGGG -A CCCCC -a TTTT -o out.1.fastq -p out.2.fastq in.1.fastq in.2.fastq
Here, the adapter pairs are (AAAAA
, CCCCC
) and (GGGG
, TTTT
). That is, paired-end
reads will only be trimmed if either
AAAAA
is found in R1 andCCCCC
is found in R2,- or
GGGG
is found in R1 andTTTT
is found in R2.
The --pair-adapters
option can be used also when demultiplexing.
There is one limitation of the algorithm at the moment: The program looks for the best-matching R1 adapter first and then checks whether the corresponding R2 adapter can be found. If not, the read pair remains unchanged. However, it is in theory possible that a different R1 adapter that does not fit as well would have a partner that can be found. Some read pairs may therefore remain untrimmed.
New in version 2.1.
Interleaved paired-end reads¶
Cutadapt supports reading and writing paired-end reads from a single FASTQ file
in which the entries for the first and second read from each pair alternate.
The first read in each pair comes before the second. This is called “interleaved”
format. Enable this file format by adding the --interleaved
option to the
command-line. Then, if you provide only a single file where usually two would be
expected, reads are automatically read or written interleaved.
For example, to read interleaved from reads.fastq
and to write interleaved to trimmed.fastq
:
cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.fastq reads.fastq
In the following example, the input reads.fastq
is interleaved, but output is
written to two files trimmed.1.fastq
and trimmed.2.fastq
:
cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq -p trimmed.2.fastq reads.fastq
Reading two-file input and writing interleaved is also possible by providing a second input file:
cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq reads.1.fastq reads.2.fastq
The following options also supported interleaved output:
* ``--untrimmed-output`` (omit ``--untrimmed-paired-output``)
* ``--too-short-output`` (omit ``--too-short-paired-output``)
* ``--too-long-output`` (omit ``--too-long-paired-output``)
If you omit --interleaved
but trim paired-end files, the above options must be used in pairs.
Cutadapt will detect if an input file is not properly interleaved by checking whether read names match and whether the file contains an even number of entries.
Trimming paired-end reads separately¶
Warning
Trimming paired-end data in this way is not recommended as it
bypasses all paired-end error-checking, such as checking whether
the number of reads is the same in both files. You should use
the normal paired-end trimming mode with the -o
/--p
options described above.
If you do not use any of the filtering options that discard reads, such
as --discard
, --minimum-length
or --maximum-length
, you can run
Cutadapt on each file separately:
cutadapt -a ADAPTER_FWD -o trimmed.1.fastq.gz reads1.fastq.gz
cutadapt -a ADAPTER_REV -o trimmed.2.fastq.gz reads2.fastq.gz
You can use the options that are listed under ‘Additional modifications’ in Cutadapt’s help output without problems. For example, if you want to quality-trim the first read in each pair with a threshold of 10, and the second read in each pair with a threshold of 15, then the commands could be:
cutadapt -q 10 -a ADAPTER_FWD -o trimmed.1.fastq reads1.fastq
cutadapt -q 15 -a ADAPTER_REV -o trimmed.2.fastq reads2.fastq
Note
Previous Cutadapt versions (up to 1.18) had a “legacy mode” that was
activated under certain conditions and in which the read-modifying
options such as -q
would only apply to the forward/R1 reads.
This mode no longer exists.
Multiple adapters¶
It is possible to specify more than one adapter sequence by using the options
-a
, -b
and -g
more than once. Any combination is allowed, such as
five -a
adapters and two -g
adapters. Each read will be searched for
all given adapters, but only the best matching adapter is removed. (But it
is possible to trim more than one adapter from each
read). This is how a command may look to trim one of two
possible 3’ adapters:
cutadapt -a TGAGACACGCA -a AGGCACACAGGG -o output.fastq input.fastq
The adapter sequences can also be read from a FASTA file. Instead of giving an
explicit adapter sequence, you need to write file:
followed by the name of
the FASTA file:
cutadapt -a file:adapters.fasta -o output.fastq input.fastq
All of the sequences in the file adapters.fasta
will be used as 3’
adapters. The other adapter options -b
and -g
also support this.
The file:
syntax can be combined with the regular way of specifying an
adapter. But no matter how you specify multiple adapter sequences, remember
that only the best matching adapter is trimmed from each read.
When Cutadapt has multiple adapter sequences to work with, either specified explicitly on the command line or via a FASTA file, it decides in the following way which adapter should be trimmed:
- All given adapter sequences are matched to the read.
- Adapter matches where the overlap length (see the
-O
parameter) is too small or where the error rate is too high (-e
) are removed from further consideration. - Among the remaining matches, the one with the greatest number of matching bases is chosen.
- If there is a tie, the first adapter wins. The order of adapters is the order in which they are given on the command line or in which they are found in the FASTA file.
If your adapter sequences are all similar and differ only by a variable barcode sequence, you can use a single adapter sequence instead that contains wildcard characters.
If you want to search for a combination of a 5’ and a 3’ adapter, you may want to provide them as a single so-called “linked adapter” instead.
Named adapters¶
Cutadapt reports statistics for each adapter separately. To identify the adapters, they are numbered and the adapter sequence is also printed:
=== Adapter 1 ===
Sequence: AACCGGTT; Length 8; Trimmed: 5 times.
If you want this to look a bit nicer, you can give each adapter a name in this way:
cutadapt -a My_Adapter=AACCGGTT -o output.fastq input.fastq
The actual adapter sequence in this example is AACCGGTT
and the name
assigned to it is My_Adapter
. The report will then contain this name in
addition to the other information:
=== Adapter 'My_Adapter' ===
Sequence: TTAGACATATCTCCGTCG; Length 18; Trimmed: 5 times.
When adapters are read from a FASTA file, the sequence header is used as the adapter name.
Adapter names are also used in column 8 of info files.
Demultiplexing¶
Cutadapt supports demultiplexing, which means that reads are written to different
output files depending on which adapter was found in them. To use this, include
the string {name}
in the name of the output file and give each adapter
a name.
The path is then interpreted as a template and each trimmed read is written
to the path in which {name}
is replaced with the name of the adapter that
was found in the read. Reads in which no adapter was found will be written to a
file in which {name}
is replaced with unknown
.
Example:
cutadapt -a one=TATA -a two=GCGC -o trimmed-{name}.fastq.gz input.fastq.gz
This command will create the three files demulti-one.fastq.gz
,
demulti-two.fastq.gz
and demulti-unknown.fastq.gz
.
More realistically, your “adapters” would actually be barcode sequences that you
will want to provide in a FASTA file. Here is a
made-up example for such a barcodes.fasta
file:
>barcode01
^TTAAGGCC
>barcode02
^TAGCTAGC
>barcode03
^ATGATGAT
Our barcodes are located at the 5’ end of the R1 read, so we made sure to use
anchored 5’ adapters by prefixing
each sequence with the ^
character. We will then use -g file:barcodes.fasta
,
where the -g
option specifies that our adapters are 5’ adapters.
These barcode sequences have a length of 8, which means that Cutadapt
would not allow any errors when matching them: The default is to allow 10%
errors, but 10% of 8 is 0.8, which is rounded down to 0. To allow one
error, we increase the maximum error rate to 15% with -e 0.15
.
Finally, we also use --no-indels
because we don’t want to allow
insertions or deletions. Also, with the --no-indels
option, Cutadapt can
use a different algorithm and demultiplexing will be many times faster.
Here is the final command:
cutadapt -e 0.15 --no-indels -g file:barcodes.fasta -o "trimmed-{name}.fastq.gz" input.fastq.gz
Demultiplexing is also supported for paired-end data if you provide the {name}
template
in both output file names (-o
and -p
). Example:
cutadapt -e 0.15 --no-indels -g file:barcodes.fasta -o trimmed-{name}.1.fastq.gz -p trimmed-{name}.2.fastq.gz input.1.fastq.gz input.2.fastq.gz
Paired-end demultiplexing always uses the adapter matches of the first read to decide where a
read should be written. If adapters for read 2 are given (-A
/-G
), they are detected and
removed as normal, but these matches do not influence where the read pair is written. This is
to ensure that read 1 and read 2 are always synchronized.
To demultiplex using a barcode that is located on read 2, you can swap the roles of R1 and R2 for both the input and output files
cutadapt -e 0.15 --no-indels -g file:barcodes.fasta -o trimmed-{name}.2.fastq.gz -p trimmed-{name}.1.fastq.gz input.2.fastq.gz input.1.fastq.gz
If you do this in a script or pipeline, it may be a good idea to add a comment to clarify that this reversal of R1 and R2 is intended.
More advice on demultiplexing:
- You can use
--untrimmed-output
to change the name of the output file that receives the untrimmed reads (those in which no barcode could be found). - Similarly, you can use
--untrimmed-paired-output
to change the name of the output file that receives the untrimmed R2 reads. - If you want to demultiplex, but keep the barcode in the reads, use the option
--action=none
.
Demultiplexing paired-end reads with combinatorial dual indexes¶
Illumina’s combinatorial dual indexing strategy uses a set of indexed adapters on R1 and another one on R2. Unlike unique dual indexes (UDI), all combinations of indexes are possible.
For demultiplexing this type of data (“combinatorial demultiplexing”), it is necessary to write each read pair to an output file depending on the adapters found on R1 and R2.
Doing this with Cutadapt is similar to doing normal demultiplexing as described above, but you need
to use {name1}}
and {name2}
in both output file name templates. For example:
cutadapt \
-e 0.15 --no-indels \
-g file:barcodes_fwd.fasta \
-G file:barcodes_rev.fasta \
-o {name1}-{name2}.1.fastq.gz -p {name1}-{name2}.2.fastq.gz \
input.1.fastq.gz input.2.fastq.gz
The {name1}
will be replaced with the name of the best-matching R1 adapter and {name2}}
will
be replaced with the name of the best-matching R2 adapter.
If there was no match of an R1 adapter, {name1}
is set to “unknown”, and if there is no match of
an R2 adapter, {name2}
is set to “unknown”. To discard read pairs for which one or both adapters
could not be found, use --discard-untrimmed
.
The --untrimmed-output
and --untrimmed-paired-output
options cannot be used.
Read the demultiplexing section for how to choose the error rate etc. Also, the tips below about how to speed up demultiplexing apply even with combinatorial demultiplexing.
When doing the above, you will end up with lots of files named first-second.x.fastq.gz
, where
first is the name of the first indexed adapter and second is the name of the second indexed
adapter, and x is 1 or 2. Each indexed adapter combination may correspond to a sample name and
you may want to name your files according to the sample name, not the name of the adapters.
Cutadapt does not have built-in functionality to achieve this, but you can use an external
tool such as mmv
(“multiple move”). First, create a list of patterns in patterns.txt
:
fwdindex1-revindex1.[12].fastq.gz sampleA.#1.fastq.gz
fwdindex1-revindex2.[12].fastq.gz sampleB.#1.fastq.gz
fwdindex1-revindex3.[12].fastq.gz sampleC.#1.fastq.gz
fwdindex2-revindex1.[12].fastq.gz sampleD.#1.fastq.gz
fwdindex2-revindex2.[12].fastq.gz sampleE.#1.fastq.gz
...
Here, fwdindex1/revindex1 etc. are the names of indexes, and sampleA etc. are your sample names. Then rename all files at once with
mmv < patterns.txt
New in version 2.4.
Speeding up demultiplexing¶
Finding many adapters/barcodes simultaneously (which is what demultiplexing in Cutadapt is about), can be sped up tremendously by using the right options since Cutadapt will then be able to create an index of the barcode sequences instead of checking for each barcode separately. Currently, the following conditions need to be met in order for index creation to be enabled:
- The barcodes/adapters must be anchored 5’ adapters (
-g ^ADAPTER
) or anchored 3’ adapters (-a ADAPTER$
). If you usefile:
to read in the adapter sequences from a FASTA file, remember to add the^
or$
to each sequence in the FASTA file. - The maximum error rate (
-e
) must be set such that at most 2 errors are allowed, so use-e 0
,-e 1
or-e 2
. - No IUPAC wildcards must be used in the barcode/adapter. Also, you cannot use the option
--match-read-wildcards
.
An index will be built for all the adapters that fulfill these criteria if there are at least two of them. You can provide additional adapters/barcodes, and they will just not be included in the index. Whether an index is created or not should not affect the results, only how fast you get them.
To see whether an index is created, look for a message like this in the first few lines of Cutadapt’s output:
Building index of 23 adapters ...
Hopefully some of the above restrictions will be lifted in the future.
New in version 1.15: Demultiplexing of paired-end data.
New in version 2.0: Added ability to use an index of adapters for speeding up demultiplexing
New in version An: index can be built even when indels are allowed (that is, --no-indels
is no longer required).
Demultiplexing paired-end reads in mixed orientation¶
For some protocols, the barcode will be located either on R1 or on R2 depending on the orientation in which the DNA fragment was sequenced.
For example, the read layout could be either this
R1: barcode-forwardprimer-sequence R2: reverseprimer-sequence
or this
R1: reverseprimer-sequence R2: barcode-forwardprimer-sequence
To demultiplex such data with Cutadapt, choose one of the orientations first and demultiplex the reads as if only that existed in the data, using a command like this
cutadapt -g file:barcodes.fasta \
-o round1-{name}.R1.fastq.gz \
-p round1-{name}.R2.fastq.gz \
R1.fastq.gz R2.fastq.gz
Then all the read pairs in which no barcode could be found will end up in
round1-unknown.R1.fastq.gz
and round1-unknown.R2.fastq.gz
. This will
also include the pairs in which the barcode was not actually in R1, but in R2. To
demultiplex these reads as well, run Cutadapt a second time with those “unknown”
files as input, but also reverse the roles of R1 and R2
cutadapt -g file:barcodes.fasta \
-o round2-{name}.R2.fastq.gz \
-p round2-{name}.R1.fastq.gz \
round1-unknown.R2.fastq.gz round1-unknown.R1.fastq.gz
Trimming more than one adapter from each read¶
By default, at most one adapter sequence is removed from each read, even if
multiple adapter sequences were provided. This can be changed by using the
--times
option (or its abbreviated form -n
). Cutadapt will then search
for all the given adapter sequences repeatedly, either until no adapter match
was found or until the specified number of rounds was reached.
As an example, assume you have a protocol in which a 5’ adapter gets ligated to your DNA fragment, but it’s possible that the adapter is ligated more than once. So your sequence could look like this:
ADAPTERADAPTERADAPTERmysequence
To be on the safe side, you assume that there are at most five copies of the adapter sequence. This command can be used to trim the reads correctly:
cutadapt -g ^ADAPTER -n 5 -o output.fastq.gz input.fastq.gz
To search for a combination of a 5’ and a 3’ adapter, have a look at the support for “linked adapters” instead, which works better for that particular case because it is allows you to require that the 3’ adapter is trimmed only when the 5’ adapter also occurs, and it cannot happen that the same adapter is trimmed twice.
Before Cutadapt supported linked adapters, the --times
option was the
recommended way to search for 5’/3’ linked adapters. For completeness, we
describe how it was done. For example, when the 5’ adapter is FIRST and the
3’ adapter is SECOND, then the read could look like this:
FIRSTmysequenceSECOND
That is, the sequence of interest is framed by the 5’ and the 3’ adapter. The following command would be used to trim such a read:
cutadapt -g ^FIRST -a SECOND -n 2 ...
Illumina TruSeq¶
Illumina makes their adapter sequences available in the Illumina Adapter Sequences Document.
As an example for how to use that information with Cutadapt, we show
how to trim TruSeq adapters. The document gives the adapter sequence
for read 1 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
and for read 2
as AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
. When using Cutadapt, this
means you should trim your paired-end data as follows:
- cutadapt
- -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o trimmed.R1.fastq.gz -p trimmed.R2.fastq.gz reads.R1.fastq.gz reads.R2.fastq.gz
See also the section about paired-end adapter trimming above.
Keep in mind that Cutadapt removes the adapter that it finds and also the sequence following it, so even if the actual adapter sequence that is used in a protocol is longer than that (and possibly contains a variable index), it is sufficient to specify a prefix of the sequence(s).
Note
Previous versions of this document also recommended using AGATCGGAAGAGC
as adapter sequence for both read 1 and read 2, but you should avoid doing so
as that sequence occurs multiple times in the human genome.
Some older information is also available in the document Illumina TruSeq Adapters De-Mystified, but keep in mind that it does not cover newer protocols.
Under some circumstances, you may want to consider not trimming adapters at all. For example, a good library prepared for exome, genome or transcriptome sequencing should contain very few reads with adapters anyway. Also, some read mapping programs including BWA-MEM and STAR will soft-clip bases at the 3’ ends of reads that do not match the reference, which will take care of adapters implicitly.
Warning about incomplete adapter sequences¶
Sometimes Cutadapt’s report ends with these lines:
WARNING:
One or more of your adapter sequences may be incomplete.
Please see the detailed output above.
Further up, you’ll see a message like this:
Bases preceding removed adapters:
A: 95.5%
C: 1.0%
G: 1.6%
T: 1.6%
none/other: 0.3%
WARNING:
The adapter is preceded by "A" extremely often.
The provided adapter sequence may be incomplete.
To fix the problem, add "A" to the beginning of the adapter sequence.
This means that in 95.5% of the cases in which an adapter was removed from a
read, the base coming before that was an A
. If your DNA fragments are
not random, such as in amplicon sequencing, then this is to be expected and
the warning can be ignored. If the DNA fragments are supposed to be random,
then the message may be genuine: The adapter sequence may be incomplete and
should include an additional A
in the beginning.
This warning exists because some documents list the Illumina TruSeq adapters
as starting with GATCGGA...
. While that is technically correct, the
library preparation actually results in an additional A
before that
sequence, which also needs to be removed. See the previous
section for the correct sequence.
Dealing with N
bases¶
Cutadapt supports the following options to deal with N
bases in your reads:
--max-n COUNT
- Discard reads containing more than COUNT
N
bases. A fractional COUNT between 0 and 1 can also be given and will be treated as the proportion of maximally allowedN
bases in the read. --trim-n
Remove flanking
N
bases from each read. That is, a read such as this:NNACGTACGTNNNN
Is trimmed to just
ACGTACGT
. This option is applied after adapter trimming. If you want to get rid ofN
bases before adapter removal, use quality trimming:N
bases typically also have a low quality value associated with them.
Cutadapt’s output¶
Reporting¶
Cutadapt will by default print a full report after it has finished processing
the reads. To suppress all output except error messages, use the option
--quiet
.
The report type can be changed to a one-line summary with the option
--report=minimal
. The output will be a tab-separated table (tsv) with one
header row and one row of content. Here is an example:
$ cutadapt --report=minimal -a ... -m 20 -q 10 -o ... -p ... in.[12].fastq.gz
status in_reads in_bp too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp w/adapters2 qualtrim2_bp out2_bp
OK 1000000 202000000 24827 0 0 975173 28968 1674222 97441426 0 0 98492473
This is the meaning of each column:
Column heading | Explanation |
---|---|
status | Incomplete adapter warning (OK or WARN ) |
in_reads | Number of processed reads (read pairs for paired-end) |
in_bp | Number of processed basepairs |
too_short | Number of reads/read pairs that were too short |
too_long | Number of reads/read pairs that were too long |
too_many_n | Number of reads/read pairs that contained too many N |
out_reads | Number of reads written |
w/adapters | Number of reads containing at least one adapter |
qualtrim_bp | Number of bases removed from R1 reads by quality trimming |
out_bp | Number of bases written to R1 reads |
w/adapters2 | Number of R2 reads containing at least one adapter |
qualtrim2_bp | Number of bases removed from R3 reads by quality trimming |
out2_bp | Number of bases written |
The last three fields are omitted for single-end data.
How to read the report¶
After every run, Cutadapt prints out per-adapter statistics. The output starts with something like this:
Sequence: 'ACGTACGTACGTTAGCTAGC'; Length: 20; Trimmed: 2402 times.
The meaning of this should be obvious. If option --revcomp
was used,
this line will additionally contain something like Reverse-complemented:
984 times
. This describes how many times of the 2402 total times the
adapter was found on the reverse complement of the read.
The next piece of information is this:
No. of allowed errors:
0-7 bp: 0; 8-15 bp: 1; 16-20 bp: 2
The adapter, as was shown above, has a length of 20 characters. We are using a custom error rate of 0.12. What this implies is shown above: Matches up to a length of 7 bp are allowed to have no errors. Matches of lengths 8-15 bp are allowd to have 1 error and matches of length 16 or more can have 2 errors. See also the section about error-tolerant matching.
Finally, a table is output that gives more detailed information about the lengths of the removed sequences. The following is only an excerpt; some rows are left out:
Overview of removed sequences
length count expect max.err error counts
3 140 156.2 0 140
4 57 39.1 0 57
5 50 9.8 0 50
6 35 2.4 0 35
7 13 0.3 0 1 12
8 31 0.1 1 0 31
...
100 397 0.0 3 358 36 3
The first row tells us the following: Three bases were removed in 140 reads; randomly, one would expect this to occur 156.2 times; the maximum number of errors at that match length is 0 (this is actually redundant since we know already that no errors are allowed at lengths 0-7 bp).
The last column shows the number of reads that had 0, 1, 2 … errors. In the last row, for example, 358 reads matched the adapter with zero errors, 36 with 1 error, and 3 matched with 2 errors.
In the row for length 7 is an apparent anomaly, where the max.err column is 0 and yet we have 31 reads matching with 1 error. This is because the matches are actually contributed by alignments to the first 8 bases of the adapter with one deletion, so 7 bases are removed but the error cut-off applied is for length 8.
The “expect” column gives only a rough estimate of the number of
sequences that is expected to match randomly, but it can help to
estimate whether the matches that were found are true adapter matches
or if they are due to chance. At lengths 6, for example, only 2.4
reads are expected, but 35 do match, which hints that most of these
matches are due to actual adapters.
For slightly more accurate estimates, you can provide the correct
GC content (as a percentage) of your reads with the option
--gc-content
. The default is --gc-content=50
.
Note that the “length” column refers to the length of the removed sequence. That is, the actual length of the match in the above row at length 100 is 20 since that is the adapter length. Assuming the read length is 100, the adapter was found in the beginning of 397 reads and therefore those reads were trimmed to a length of zero.
The table may also be useful in case the given adapter sequence contains an error. In that case, it may look like this:
...
length count expect max.err error counts
10 53 0.0 1 51 2
11 45 0.0 1 42 3
12 51 0.0 1 48 3
13 39 0.0 1 0 39
14 40 0.0 1 0 40
15 36 0.0 1 0 36
...
We can see that no matches longer than 12 have zero errors. In this case, it indicates that the 13th base of the given adapter sequence is incorrect.
Format of the info file¶
When the --info-file
command-line parameter is given, detailed
information about where adapters were found in each read are written
to the given file. It is a tab-separated text file that contains at
least one row per input read. Normally, there is exactly one row per
input read, but in the following cases, multiple rows may be output:
- The option
--times
is in use.- A linked adapter is used.
A row is written for all input reads, even those that are discarded
from the final FASTA/FASTQ output due to filtering options
(such as --minimum-length
). Which fields are output in each row
depends on whether an adapter match was found in the read or not.
The fields in a row that describes a match are:
- Read name
- Number of errors
- 0-based start coordinate of the adapter match
- 0-based end coordinate of the adapter match
- Sequence of the read to the left of the adapter match (can be empty)
- Sequence of the read that was matched to the adapter
- Sequence of the read to the right of the adapter match (can be empty)
- Name of the found adapter.
- Quality values corresponding to sequence left of the adapter match (can be empty)
- Quality values corresponding to sequence matched to the adapter (can be empty)
- Quality values corresponding to sequence to the right of the adapter match (can be empty)
The concatenation of the fields 5-7 yields the full read sequence. Column 8 identifies the found adapter. The section about named adapters <named-adapters> describes how to give a name to an adapter. Adapters without a name are numbered starting from 1. Fields 9-11 are empty if quality values are not available. Concatenating them yields the full sequence of quality values.
If no adapter was found, the format is as follows:
- Read name
- The value -1 (use this to distinguish between match and non-match)
- The read sequence
- Quality values
When parsing the file, be aware that additional columns may be added in the future. Also, some fields can be empty, resulting in consecutive tabs within a line.
If the --times
option is used and greater than 1, each read can appear
more than once in the info file. There will be one line for each found adapter,
all with identical read names. Only for the first of those lines will the
concatenation of columns 5-7 be identical to the original read sequence (and
accordingly for columns 9-11). For subsequent lines, the shown sequence are the
ones that were used in subsequent rounds of adapter trimming, that is, they get
successively shorter.
Linked adapters appear with up to two rows for each read, one for each constituent
adapter for which a match has been found. To be able to see which of the two
adapters a row describes, the adapter name in column 8 is modified: If the row
describes a match of the 5’ adapter, the string ;1
is added. If it describes
a match of the 3’ adapter, the string ;2
is added. If there are two rows, the
5’ match always comes first.
New in version 1.9: Columns 9-11 were added.
New in version 2.8: Linked adapters in info files work.