Recipes (FAQ)¶
This section gives answers to frequently asked questions. It shows you how to get cutadapt to do what you want it to do!
Remove more than one adapter¶
If you want to remove a 5’ and 3’ adapter at the same time, use the support for linked adapters.
If your situation is different, for example, when you have many 5’ adapters but only one 3’ adapter, then you have two options.
First, you can specify the adapters and also --times=2 (or the short
version -n 2). For example:
cutadapt -g ^TTAAGGCC -g ^AAGCTTA -a TACGGACT -n 2 -o output.fastq input.fastq
This instructs cutadapt to run two rounds of adapter finding and removal. That means that, after the first round and only when an adapter was actually found, another round is performed. In both rounds, all given adapters are searched and removed. The problem is that it could happen that one adapter is found twice (so the 3’ adapter, for example, could be removed twice).
The second option is to not use the -n option, but to run cutadapt twice,
first removing one adapter and then the other. It is easiest if you use a pipe
as in this example:
cutadapt -g ^TTAAGGCC -g ^AAGCTTA input.fastq | cutadapt -a TACGGACT - > output.fastq
Trim poly-A tails¶
If you want to trim a poly-A tail from the 3’ end of your reads, use the 3’
adapter type (-a) with an adapter sequence of many repeated A
nucleotides. Starting with version 1.8 of cutadapt, you can use the
following notation to specify a sequence that consists of 100 A:
cutadapt -a "A{100}" -o output.fastq input.fastq
This also works when there are sequencing errors in the poly-A tail. So this read
TACGTACGTACGTACGAAATAAAAAAAAAAA
will be trimmed to:
TACGTACGTACGTACG
If for some reason you would like to use a shorter sequence of A, you can
do so: The matching algorithm always picks the leftmost match that it can find,
so cutadapt will do the right thing even when the tail has more A than you
used in the adapter sequence. However, sequencing errors may result in shorter
matches than desired. For example, using -a "A{10}", the read above (where
the AAAT is followed by eleven A) would be trimmed to:
TACGTACGTACGTACGAAAT
Depending on your application, perhaps a variant of -a A{10}N{90} is an
alternative, forcing the match to be located as much to the left as possible,
while still allowing for non-A bases towards the end of the read.
Trim a fixed number of bases after adapter trimming¶
If the adapters you want to remove are preceded by some unknown sequence (such as a random tag/molecular identifier), you can specify this as part of the adapter sequence in order to remove both in one go.
For example, assume you want to trim Illumina adapters preceded by 10 bases that you want to trim as well. Instead of this command:
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
Use this command:
cutadapt -O 13 -a N{10}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
The -O 13 is the minimum overlap for an adapter match, where the 13 is
computed as 3 plus 10 (where 3 is the default minimum overlap and 10 is the
length of the unknown section). If you do not specify it, the adapter sequence
would match the end of every read (because N matches anything), and ten
bases would then be removed from every read.
Trimming (amplicon-) primers from both ends of paired-end reads¶
If you want to remove primer sequences that flank your sequence of interest, you should use a “linked adapter” to remove them. If you have paired-end data (with R1 and R2), you can correctly trim both R1 and R2 by using linked adapters for both R1 and R2. Here is how to do this.
The full DNA fragment that is put on the sequencer looks like this (looking only at the forward strand):
5’ sequencing primer – forward primer – sequence of interest – reverse complement of reverse primer – reverse complement of 3’ sequencing primer
Since sequencing of R1 starts after the 5’ sequencing primer, R1 will start with the forward primer and then continue into the sequence of interest and into the two primers to the right of it, depending on the read length and how long the sequence of interest is. For R1, the linked adapter option that needs to be used is therefore
-a FWDPRIMER...RCREVPRIMER
where FWDPRIMER needs to be replaced with the sequence of your
forward primer and RCREVPRIMER with the reverse complement of
the reverse primer. The three dots ... need to be entered
as they are – they tell cutadapt that this is a linked adapter
with a 5’ and a 3’ part.
Sequencing of R2 starts before the 3’ sequencing primer and proceeds along the reverse-complementary strand. For the correct linked adapter, the sequences from above therefore need to be swapped and reverse-complemented:
-A REVPRIMER...RCFWDPRIMER
The uppercase -A specifies that this option is
meant to work on R2. Similar to above, REVPRIMER is
the sequence of the reverse primer and RCFWDPRIMER is the
reverse-complement of the forward primer. Note that cutadapt
does not reverse-complement any sequences of its own; you
will have to do that yourself.
Finally, you may want to filter the trimmed read pairs.
Use --discard-untrimmed to throw away all read pairs in
which R1 doesn’t start with FWDPRIMER or in which R2
does not start with REVPRIMER.
A note on how the filtering works: In linked adapters, by default
the first part (before the ...) is anchored. Anchored
sequences must occur. If they don’t, then the other sequence
(after the ...) is not even searched for and the entire
read is internally marked as “untrimmed”. This is done for both
R1 and R2 and as soon as any of them is marked as “untrimmed”,
the entire pair is considered to be “untrimmed”. If
--discard-untrimmed is used, this means that the entire
pair is discarded if R1 or R2 are untrimmed. (Option
--pair-filter=both can be used to change this to require
that both were marked as untrimmed.)
In summary, this is how to trim your data and discard all read pairs that do not contain the primer sequences that you know must be there:
cutadapt -a FWDPRIMER...RCREVPRIMER -A REVPRIMER...RCFWDPRIMER --discard-untrimmed -o out.1.fastq.gz -p out.2.fastq.gz in.1.fastq.gz in.2.fastq.gz
Piping paired-end data¶
Sometimes it is necessary to run cutadapt twice on your data. For example, when
you want to change the order in which read modification or filtering options are
applied. To simplify this, you can use Unix pipes (|), but this is more
difficult with paired-end data since then input and output consists of two files
each.
The solution is to interleave the paired-end data, send it over the pipe and then de-interleave it in the other process. Here is how this looks in principle:
cutadapt [options] --interleaved in.1.fastq.gz in.2.fastq.gz | \
cutadapt [options] --interleaved -o out.1.fastq.gz -p out.2.fastq.gz -
Note the - character in the second invocation to cutadapt.
Other things (unfinished)¶
- How to detect adapters
- Use cutadapt for quality-trimming only
- Use it for minimum/maximum length filtering
- Use it for conversion to FASTQ