======= Recipes ======= This section contains short how-to guides for doing certain tasks. Remove more than one adapter ---------------------------- If you want to remove a 5' and 3' adapter at the same time, :ref:`use the support for linked adapters `. If your situation is different, for example, when you have many 5' adapters but only one 3' adapter, then you have two options. First, you can specify the adapters and also ``--times=2`` (or the short version ``-n 2``). For example:: cutadapt -g ^TTAAGGCC -g ^AAGCTTA -a TACGGACT -n 2 -o output.fastq input.fastq This instructs Cutadapt to run two rounds of adapter finding and removal. That means that, after the first round and only when an adapter was actually found, another round is performed. In both rounds, all given adapters are searched and removed. The problem is that it could happen that one adapter is found twice (so the 3' adapter, for example, could be removed twice). The second option is to not use the ``-n`` option, but to run Cutadapt twice, first removing one adapter and then the other. It is easiest if you use a pipe as in this example:: cutadapt -g ^TTAAGGCC -g ^AAGCTTA input.fastq | cutadapt -a TACGGACT - > output.fastq Separating trimmed and untrimmed reads -------------------------------------- To send trimmed and untrimmed reads to separate output files, use the the ``--untrimmed-output`` option:: cutadapt -a TTAAGGCC --untrimmed-output=untrimmed.fastq.gz -o trimmed.fastq.gz input.fastq.gz For paired-end data, use also the ``--untrimmed-paired-output`` option:: cutadapt \ -g ^AAGGCC \ -G ^TTGGAA \ --untrimmed-output=untrimmed.1.fastq.gz \ --untrimmed-paired-output=untrimmed.2.fastq.gz -o trimmed.2.fastq.gz \ -p trimmed.2.fastq.gz \ input.1.fastq.gz \ input.2.fastq.gz Trim poly-A tails ----------------- Use ``--poly-a``, see :ref:`poly-A trimming `. In versions of Cutadapt earlier than 4.4, the recommendation was to use ``-a "A{100}"`` for poly-A-trimming, but the ``--poly-a`` option is more accurate and much faster. Trim a fixed number of bases preceding each adapter --------------------------------------------------- If the adapters you want to remove are preceded by some unknown sequence (such as a random tag/molecular identifier), you can specify this as part of the adapter sequence in order to remove both in one go. For example, assume you want to trim Illumina adapters preceded by 10 bases that you want to trim as well. Instead of this command:: cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ... Use this command:: cutadapt -O 13 -a N{10}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ... The ``-O 13`` is the minimum overlap for an adapter match, where the 13 is computed as 3 plus 10 (where 3 is the default minimum overlap and 10 is the length of the unknown section). If you do not specify it, the adapter sequence would match the end of every read (because ``N`` matches anything), and ten bases would then be removed from every read. Trimming (amplicon-) primers from paired-end reads -------------------------------------------------- If the reads are shorter than the amplicon, use :: cutadapt -g ^FWDPRIMER -G ^REVPRIMER --discard-untrimmed -o out.1.fastq.gz -p out.2.fastq.gz in.1.fastq.gz in.2.fastq.gz If the reads can be longer than the amplicon, use a :ref:`"linked adapter" `:: cutadapt -a ^FWDPRIMER...RCREVPRIMER -A ^REVPRIMER...RCFWDPRIMER --discard-untrimmed -o out.1.fastq.gz -p out.2.fastq.gz in.1.fastq.gz in.2.fastq.gz You need to insert your own sequences as follows. The three dots ``...`` need to be written as they are. FWDPRIMER Sequence of the forward primer REVPRIMER Sequence of the reverse primer RCFWDPRIMER Reverse-complemented sequence of the forward primer RCREVPRIMER Reverse-complemented sequence of the reverse primer Explanation ~~~~~~~~~~~ The full DNA fragment that is put on the sequencer looks like this (looking only at the forward strand): 5' sequencing primer -- forward primer -- sequence of interest -- reverse complement of reverse primer -- reverse complement of 3' sequencing primer Since sequencing of R1 starts after the 5' sequencing primer, R1 will start with the forward primer and then continue into the sequence of interest and possibly into the two primers to the right of it, depending on the read length and how long the sequence of interest is. If the reads are sufficiently short, R1 will not extend into the reverse primer, and R2 will not extend into the forward primer. In that case, only the forward primer on R1 and the reverse primer on R2 need to be removed:: -g ^FWDPRIMER -G ^REVPRIMER --discard-untrimmed If the reads are so long that they can possibly extend into the primer on the respective other side, :ref:`linked adapters ` for both R1 and R2 can be used. For R1:: -a ^FWDPRIMER...RCREVPRIMER Sequencing of R2 starts before the 3' sequencing primer and proceeds along the reverse-complementary strand. For the correct linked adapter, the sequences from above therefore need to be swapped and reverse-complemented:: -A ^REVPRIMER...RCFWDPRIMER The uppercase ``-A`` specifies that this option is meant to work on R2. Cutadapt does not reverse-complement any sequences of its own; you will have to do that yourself. Finally, you may want to filter the trimmed read pairs. Option ``--discard-untrimmed`` throws away all read pairs in which R1 doesn’t start with ``FWDPRIMER`` or in which R2 does not start with ``REVPRIMER``. A note on how the filtering works: In linked adapters, by default the first part (before the ``...``) is anchored. Anchored sequences *must* occur. If they don’t, then the other sequence (after the ``...``) is not even searched for and the entire read is internally marked as “untrimmed”. This is done for both R1 and R2 and as soon as any of them is marked as “untrimmed”, the entire pair is considered to be “untrimmed”. If ``--discard-untrimmed`` is used, this means that the entire pair is discarded if R1 or R2 are untrimmed. (Option ``--pair-filter=both`` can be used to change this to require that *both* were marked as untrimmed.) Piping paired-end data ---------------------- Sometimes it is necessary to run Cutadapt twice on your data. For example, when you want to change the order in which read modification or filtering options are applied. To simplify this, you can use Unix pipes (``|``), but this is more difficult with paired-end data since then input and output consists of two files each. The solution is to interleave the paired-end data, send it over the pipe and then de-interleave it in the other process. Here is how this looks in principle:: cutadapt [options] --interleaved in.1.fastq.gz in.2.fastq.gz | \ cutadapt [options] --interleaved -o out.1.fastq.gz -p out.2.fastq.gz - Note the ``-`` character in the second invocation to Cutadapt. .. _speedup: Speeding up Cutadapt -------------------- There are several tricks for limiting wall-clock time while using Cutadapt. Increasing the number of cores with ``-j`` will increase the number of reads per minute at near-linear rate. It is possible to use pipes in order to bypass the filesystem and pipe Cutadapt's output into an aligner such as BWA. The ``mkfifo`` command allows you to create named pipes. .. code-block::bash mkfifo R1.fastq R2.fastq cutadapt -a ${ADAPTER_R1} -A ${ADAPTER_R2} -o R1.fastq -p R2.fastq ${READ1} ${READ2} > cutadapt.log & \ bwa mem ${INDEX} R1.fastq R2.fastq This command will run cutadapt and BWA simultaneously, using Cutadapt’s output as BWA’s input, and capturing Cutadapt’s report in ``cutadapt.log``. .. versionadded:: 4.10 Option ``-Z`` (equivalent to ``--compression-level=1``), which was earlier recommended for speeding up processing, is now the default. Check whether a FASTQ file is properly formatted ------------------------------------------------ cutadapt -o /dev/null input.fastq Any problems with the FASTQ file will be detected and reported. Check whether FASTQ files are properly paired --------------------------------------------- cutadapt -o /dev/null -p /dev/null input.R1.fastq input.R2.fastq Any problems with the individual FASTQ files or improperly paired reads (mismatching read ids) will be detected and reported. See :ref:`the requirements for properly paired reads `. Rescuing single reads from paired-end reads that were filtered -------------------------------------------------------------- When trimming and filtering paired-end reads, Cutadapt always discards entire read pairs. If you want to keep one of the reads, you need to write the filtered read pairs to an output file and postprocess it. For example, assume you are using ``-m 30`` to discard too short reads. Cutadapt discards all read pairs in which just one of the reads is too short (but see the ``--pair-filter`` option). To recover those (individual) reads that are long enough, you can first use the ``--too-short-(paired)-output`` options to write the filtered pairs to a file, and then postprocess those files to keep only the long enough reads. cutadapt -m 30 -q 20 -o out.1.fastq.gz -p out.2.fastq.gz --too-short-output=tooshort.1.fastq.gz --too-short-paired-output=tooshort.2.fastq.gz in.1.fastq.gz in.2.fastq.gz cutadapt -m 30 -o rescued.a.fastq.gz tooshort.1.fastq.gz cutadapt -m 30 -o rescued.b.fastq.gz tooshort.2.fastq.gz The two output files ``rescued.a.fastq.gz`` and ``rescued.b.fastq.gz`` contain those individual reads that are long enough. Note that the file names do not end in ``.1.fastq.gz`` and ``.2.fastq.gz`` to make it very clear that these files no longer contain synchronized paired-end reads. .. _bisulfite: Bisulfite sequencing (RRBS) --------------------------- When trimming reads that come from a library prepared with the RRBS (reduced representation bisulfite sequencing) protocol, the last two 3' bases must be removed in addition to the adapter itself. This can be achieved by using not the adapter sequence itself, but by adding two wildcard characters to its beginning. If the adapter sequence is ``ADAPTER``, the command for trimming should be:: cutadapt -a NNADAPTER -o output.fastq input.fastq Details can be found in `Babraham bioinformatics' "Brief guide to RRBS" `_. A summary follows. During RRBS library preparation, DNA is digested with the restriction enzyme MspI, generating a two-base overhang on the 5' end (``CG``). MspI recognizes the sequence ``CCGG`` and cuts between ``C`` and ``CGG``. A double-stranded DNA fragment is cut in this way:: 5'-NNNC|CGGNNN-3' 3'-NNNGGC|CNNN-5' The fragment between two MspI restriction sites looks like this:: 5'-CGGNNN...NNNC-3' 3'-CNNN...NNNGGC-5' Before sequencing (or PCR) adapters can be ligated, the missing base positions must be filled in with GTP and CTP:: 5'-ADAPTER-CGGNNN...NNNCcg-ADAPTER-3' 3'-ADAPTER-gcCNNN...NNNGGC-ADAPTER-5' The filled-in bases, marked in lowercase above, do not contain any original methylation information, and must therefore not be used for methylation calling. By prefixing the adapter sequence with ``NN``, the bases will be automatically stripped during adapter trimming. .. _file-format-conversion: Convert FASTQ to FASTA ---------------------- Cutadapt detects the output format from the output file name extension. Convert FASTQ to FASTA format:: cutadapt -o output.fasta.gz input.fastq.gz Cutadapt detects FASTA output and omits the qualities. .. _force-fasta: If output is written to standard output, no output file name is available, so the same format as the input is used. To force FASTA output even in this case, use the ``--fasta`` option:: cutadapt --fasta input.fastq.gz > out.fasta Trim qualities -------------- Quality-trim 3' ends:: cutadapt -q 20 -o output.fastq.gz input.fastq.gz .. _json-jq: Extract information from the JSON report with ``jq`` ---------------------------------------------------- The :ref:`JSON report ` that is written when using the ``--json`` option can be read by `jq `_. Get the number of reads (or read pairs) written:: jq '.read_counts.output' mysample.cutadapt.json Get the percentage of reads that contain an adapter:: jq '.read_counts.read1_with_adapter / .read_counts.input * 100' mysample.cutadapt.json Get how often the first adapter was found:: jq '.adapters_read1[0].total_matches' mysample.cutadapt.json Quickly test how Cutadapt trims a single sequence ------------------------------------------------- Use ``echo`` to write the sequence in FASTA format, and run Cutadapt with ``--quiet``:: echo -e ">r\nAACCGGTT" | cutadapt --quiet -a CCGGTTGGAA - Output:: >r AA .. _many-samples: Processing many samples (with a for loop) ----------------------------------------- Cutadapt can only process one set of input reads or read pairs at a time. If you have multiple inputs, possibly corresponding to multiple samples, Cutadapt needs to be run once for each input. Instead of typing in each command, this can be done with a ``for`` loop in the shell. Single-end reads ~~~~~~~~~~~~~~~~ We start with the simpler case of processing many single-end files. Let’s say these are the input files:: Sample1_L001_R1_001.fastq.gz Sample2_L001_R1_001.fastq.gz Sample3_L001_R1_001.fastq.gz ... Then this loop will run ``cutadapt`` on each file and produce output files named ``trimmed-Sample1_L001_R1_001.fastq.gz`` etc.:: for f in *.fastq.gz; do cutadapt ... -o trimmed-${f} ${f} done Of course the ``...`` need to be replaced with the trimming options you want to use. You can write this on one line as well:: for f in *.fastq.gz; do cutadapt ... -o trimmed-${f} ${f}; done Paired-end reads ~~~~~~~~~~~~~~~~ Let us assume the input consists of paired-end files named like this:: Sample1_L001_R1_001.fastq.gz Sample1_L001_R2_001.fastq.gz Sample2_L001_R1_001.fastq.gz Sample2_L001_R2_001.fastq.gz Sample3_L001_R1_001.fastq.gz Sample3_L001_R2_001.fastq.gz ... Then this loop can be used to trim each file pair:: for r1 in *_R1_*.fastq.gz; do r2=${r1/_R1_/_R2_} cutadapt ... -o trimmed-${r1} -p trimmed-${r2} ${r1} ${r2} done Here, the trick is to loop only over the R1 files to ensure we run Cutadapt only once for each pair. In the ``r2=...`` line, we re-create the R2 file name from the R1 file name by replacing ``_R1_`` with ``_R2_``.