install with bioconda

Cutadapt

Cutadapt finds and removes adapter sequences, primers, poly-A tails and other types of unwanted sequence from your high-throughput sequencing reads.

Cleaning your data in this way is often required: Reads from small-RNA sequencing contain the 3’ sequencing adapter because the read is longer than the molecule that is sequenced. Amplicon reads start with a primer sequence. Poly-A tails are useful for pulling out RNA from your sample, but often you don’t want them to be in your reads.

Cutadapt helps with these trimming tasks by finding the adapter or primer sequences in an error-tolerant way. It can also modify and filter single-end and paired-end reads in various ways. Adapter sequences can contain IUPAC wildcard characters. Cutadapt can also demultiplex your reads.

Cutadapt is available under the terms of the MIT license.

Cutadapt development was started at TU Dortmund University in the group of Prof. Dr. Sven Rahmann. It is currently being developed within NBIS (National Bioinformatics Infrastructure Sweden).

If you use Cutadapt, please cite DOI:10.14806/ej.17.1.200 .

Table of contents

Installation

Cutadapt is being developed and tested under Linux. Users have run it successfully under macOS and Windows.

Quick installation

The easiest way to install Cutadapt is to use pip3 on the command line:

python3 -m pip install --user --upgrade cutadapt

This will download the software from PyPI (the Python packaging index), and install the cutadapt binary into $HOME/.local/bin. If an old version of Cutadapt exists on your system, the --upgrade parameter is required in order to install a newer version. You can then run the program like this:

~/.local/bin/cutadapt --help

If you want to avoid typing the full path, add the directory $HOME/.local/bin to your $PATH environment variable.

Installation with conda

Alternatively, Cutadapt is available as a Conda package from the bioconda channel. Install miniconda if you don’t have Conda. Then follow the Bioconda installation instructions (in particular, make sure you have both bioconda and conda-forge in your channels list).

To then install Cutadapt into a new Conda environment, use this command:

conda create -n cutadaptenv cutadapt

Here, cutadaptenv is the name of the Conda environment. (You can choose a different name.)

An environment needs to be activated every time you want to use the programs in it:

conda activate cutadaptenv

Finally, check whether it worked:

cutadapt --version

This should show the Cutadapt version number.

Installation on a Debian-based Linux distribution

Cutadapt is also included in Debian-based Linux distributions, such as Ubuntu. Simply use your favorite package manager to install Cutadapt. On the command-line, this should work

sudo apt install cutadapt

or possibly

sudo apt install python3-cutadapt

Please be aware that this will likely give you an old version of Cutadapt. If you encounter unexpected behavior, please use one of the other installation methods to get an up-to-date version before reporting bugs.

Dependencies

Cutadapt installation requires this software to be installed:

  • Python 3.6 or newer
  • Possibly a C compiler. For Linux, Cutadapt packages are provided as so-called “wheels” (.whl files) which come pre-compiled.

Under Ubuntu, you may need to install the packages build-essential and python3-dev to get a C compiler.

If you get an error message:

error: command 'gcc' failed with exit status 1

Then check the entire error message. If it says something about a missing Python.h file, then the problem is that you are missing Python development packages (python3-dev in Ubuntu).

System-wide installation (root required)

If you have root access, then you can install Cutadapt system-wide by running:

sudo python3 -m pip install cutadapt

This installs cutadapt into /usr/local/bin.

If you want to upgrade from an older version, use this command instead:

sudo python3 -m pip install --upgrade cutadapt

If the above does not work for you, then you can try to install Cutadapt into a virtual environment. This may lead to fewer conflicts with system-installed packages:

sudo python3 -m venv /usr/local/cutadapt
sudo /usr/local/cutadapt/bin/pip install cutadapt
cd /usr/local/bin/
sudo ln -s ../cutadapt/bin/cutadapt

Uninstalling

Type

pip3 uninstall cutadapt

and confirm with y to remove the package. Under some circumstances, multiple versions may be installed at the same time. Repeat the above command until you get an error message in order to make sure that all versions are removed.

Shared installation (on a cluster)

If you have a larger installation and want to provide Cutadapt as a module that can be loaded and unloaded (with the Lmod system, for example), we recommend that you create a virtual environment and ‘pip install’ cutadapt into it. These instructions work on our SLURM cluster that uses the Lmod system (replace 1.9.1 with the actual version you want to use):

BASE=/software/cutadapt-1.9.1
virtualenv $BASE/venv
$BASE/venv/bin/pip install --install-option="--install-scripts=$BASE/bin" cutadapt==1.9.1

The install-option part is important. It ensures that a second, separate bin/ directory is created (/software/cutadapt-1.9.1/bin/) that only contains the cutadapt script and nothing else. To make Cutadapt available to the users, that directory ($BASE/bin) needs to be added to the $PATH.

Make sure you do not add the bin/ directory within the venv directory to the $PATH! Otherwise, a user trying to run python who also has the cutadapt module loaded would get the python from the virtual environment, which leads to confusing error messages.

A simple module file for the Lmod system matching the above example could look like this:

conflict("cutadapt")
whatis("adapter trimming tool")
prepend_path("PATH", "/software/cutadapt-1.9.1/bin")

Please note that there is no need to “activate” the virtual environment: Activation merely adds the bin/ directory to the $PATH, so the prepend_path directive is equivalent to activating the virtual environment.

Installing the development version

We recommend that you install Cutadapt into a so-called virtual environment if you decide to use the development version. The virtual environment is a single directory that contains everything needed to run the software. Nothing else on your system is changed, so you can simply uninstall this particular version of Cutadapt by removing the directory with the virtual environment.

The following instructions work on Linux using Python 3. Make sure you have installed the dependencies (python3-dev and build-essential on Ubuntu)!

First, choose where you want to place the directory with the virtual environment and what you want to call it. Let us assume you chose the path ~/cutadapt-venv. Then use these commands for the installation:

python3 -m venv ~/cutadapt-venv
~/cutadapt-venv/bin/python3 -m pip install --upgrade pip
~/cutadapt-venv/bin/pip install git+https://github.com/marcelm/cutadapt.git#egg=cutadapt

To run Cutadapt and see the version number, type

~/cutadapt-venv/bin/cutadapt --version

The reported version number will be something like 2.2.dev5+gf564208. This means that you are now running the version of Cutadapt that will become 2.2, and that it contains 5 changes (commits) since the previous release (2.1 in this case).

User guide

Basic usage

To trim a 3’ adapter, the basic command-line for Cutadapt is:

cutadapt -a AACCGGTT -o output.fastq input.fastq

The sequence of the adapter is given with the -a option. You need to replace AACCGGTT with the correct adapter sequence. Reads are read from the input file input.fastq and are written to the output file output.fastq.

Compressed in- and output files are also supported:

cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz

Cutadapt searches for the adapter in all reads and removes it when it finds it. Unless you use a filtering option, all reads that were present in the input file will also be present in the output file, some of them trimmed, some of them not. Even reads that were trimmed to a length of zero are output. All of this can be changed with command-line options, explained further down.

Trimming of paired-end data is also supported.

Input and output file formats

The supported input and output file formats are FASTA and FASTQ, with optional compression.

The input file format is recognized from the file name extension. If the extension was not recognized or when Cutadapt reads from standard input, the contents are inspected instead.

The output file format is also recognized from the file name extension. If the extensions was not recognized or when Cutadapt writes to standard output, the same format as the input is used for the output.

See also file format conversion.

Compressed files

Cutadapt supports compressed input and output files. Whether an input file needs to be decompressed or an output file needs to be compressed is detected automatically by inspecting the file name: For example, if it ends in .gz, then gzip compression is assumed

cutadapt -a AACCGGTT -o output.fastq.gz input.fastq.gz

All of Cutadapt’s options that expect a file name support this.

The supported compression formats are gzip (.gz), bzip2 (.bz2) and xz (.xz).

The default compression level for gzip output is 6. Use option -Z to change this to level 1. The files need more space, but it is faster and therefore a good choice for short-lived intermediate files.

If available, Cutadapt uses pigz to speed up writing and reading of gzipped files.

Standard input and output

If no output file is specified via the -o option, then the output is sent to the standard output stream. Example:

cutadapt -a AACCGGTT input.fastq > output.fastq

There is one difference in behavior if you use Cutadapt without -o: The report is sent to the standard error stream instead of standard output. You can redirect it to a file like this:

cutadapt -a AACCGGTT input.fastq > output.fastq 2> report.txt

Wherever Cutadapt expects a file name, you can also write a dash (-) in order to specify that standard input or output should be used. For example:

tail -n 4 input.fastq | cutadapt -a AACCGGTT - > output.fastq

The tail -n 4 prints out only the last four lines of input.fastq, which are then piped into Cutadapt. Thus, Cutadapt will work only on the last read in the input file.

In most cases, you should probably use - at most once for an input file and at most once for an output file, in order not to get mixed output.

For the same reason, you should not use - for non-interleaved paired-end data.

You cannot combine - and gzip compression since Cutadapt needs to know the file name of the output or input file. if you want to have a gzip-compressed output file, use -o with an explicit name.

One last “trick” is to use /dev/null as an output file name. This special file discards everything you send into it. If you only want to see the statistics output, for example, and do not care about the trimmed reads at all, you could use something like this:

cutadapt -a AACCGGTT -o /dev/null input.fastq

Multi-core support

Cutadapt supports parallel processing, that is, it can use multiple CPU cores. Multi-core is not enabled by default. To enable it, use the option -j N (or the spelled-out version --cores=N), where N is the number of cores to use.

To automatically detect the number of available cores, use -j 0 (or --cores=0). The detection takes into account resource restrictions that may be in place. For example, if running Cutadapt as a batch job on a cluster system, the actual number of cores assigned to the job will be used. (This works if the cluster systems uses the cpuset(1) mechanism to impose the resource limitation.)

Make also sure that you have pigz (parallel gzip) installed if you use multiple cores and write to a .gz output file. Otherwise, compression of the output will be done in a single thread and therefore be a bottleneck.

New in version 1.15.

New in version 1.18: --cores=0 for autodetection

New in version 2.5: Multicore works with --untrimmed/too-short/too-long-(paired)-output

New in version 2.7: Multicore works with --info-file, --rest-file, --wildcard-file

New in version 3.0: Multicore support for demultiplexing added.

Speed-up tricks

There are several tricks for limiting wall-clock time while using Cutadapt.

-Z (equivalent to --compression-level=1) can be used to limit the amount of CPU time which is spent on the compression of output files. Alternatively, choosing filenames not ending with .gz, .bz2 or .xz will make sure no CPU time is spent on compression at all. On systems with slow I/O, it can actually be faster to set a higher compression-level than 1.

Increasing the number of cores with -j will increase the number of reads per minute at near-linear rate.

It is also possible to use pipes in order to bypass the filesystem and pipe cutadapt’s output into an aligner such as BWA. The mkfifo command allows you to create named pipes in bash.

This command will run cutadapt and BWA simultaneously, using Cutadapt’s output as BWA’s input, and capturing Cutadapt’s report in cutadapt.report.

Read processing stages

Cutadapt can do a lot more in addition to removing adapters. There are various command-line options that make it possible to modify and filter reads and to redirect them to various output files. Each read is processed in the following order:

  1. Read modification options are applied. This includes adapter removal, quality trimming, read name modifications etc. The order in which they are applied is the order in which they are listed in the help shown by cutadapt --help under the “Additional read modifications” heading. Adapter trimming itself does not appear in that list and is done after quality trimming and before length trimming (--length/-l).
  2. Filtering options are applied, such as removal of too short or untrimmed reads. Some of the filters also allow to redirect a read to a separate output file. The filters are applied in the order in which they are listed in the help shown by cutadapt --help under the “Filtering of processed reads” heading.
  3. If the read has passed all the filters, it is written to the output file.

Adapter types

Cutadapt can detect multiple adapter types. 5’ adapters preceed the sequence of interest and 3’ adapters follow it. Further distinctions are made according to where in the read the adapter sequence is allowed to occur.

Adapter type Command-line option
Regular 3’ adapter -a ADAPTER
Regular 5’ adapter -g ADAPTER
Non-internal 3’ adapter -a ADAPTERX
Non-internal 5’ adapter -g XADAPTER
Anchored 3’ adapter -a ADAPTER$
Anchored 5’ adapter -g ^ADAPTER
5’ or 3’ (both possible) -b ADAPTER
Linked adapter
-a ^ADAPTER1...ADAPTER2
-g ADAPTER1...ADAPTER2

By default, all adapters are searched error-tolerantly. Adapter sequences may also contain any IUPAC wildcard character (such as N).

In addition, it is possible to remove a fixed number of bases from the beginning or end of each read, to remove low-quality bases (quality trimming) from the 3’ and 5’ ends, and to search for adapters also in the reverse-complemented reads.

Overview of adapter types

3’ adapter types

A 3’ adapter is assumed to be ligated to the 3’ end of your sequence of interest. When such an adapter is found, the adapter sequence itself and the sequence following it (if there is any) are trimmed. This table shows in which ways the different 3’ adapter types are allowed to occur in a read in order to be recognized by the program.

Adapter location in read Read layout
Found by regular 3’
-a ADAPTER
Found by non-internal 3’
-a ADAPTERX
Found by anchored 3’
-a ADAPTER$
Full adapter sequence anywhere acgtacgtADAPTERacgt yes no no
Partial adapter sequence at 3’ end acgtacgtacgtADAP yes yes no
Full adapter sequence at 3’ end acgtacgtacgtADAPTER yes yes yes
5’ adapter types

A 5’ adapter is assumed to be ligated to the 5’ end of your sequence of interest. When such an adapter is found, the adapter sequence itself and the sequence preceding it (if there is any) are trimmed. This table shows in which ways the different 5’ adapter types are allowed to occur in a read in order to be recognized by the program.

Adapter location in read Read layout
Found by regular 5’
-g ADAPTER
Found by non-internal 5’
-g XADAPTER
Found by anchored 5’
-g ^ADAPTER
Full adapter sequence anywhere acgtADAPTERacgtacgt yes no no
Partial adapter sequence at 5’ end PTERacgtacgtacgt yes yes no
Full adapter sequence at 5’ end ADAPTERacgtacgtacgt yes yes yes

Regular 3’ adapters

A 3’ adapter is a piece of DNA ligated to the 3’ end of the DNA fragment you are interested in. The sequencer starts the sequencing process at the 5’ end of the fragment and sequences into the adapter if the read is long enough. The read that it outputs will then have a part of the adapter in the end. Or, if the adapter was short and the read length quite long, then the adapter will be somewhere within the read, followed by some other bases.

For example, assume your fragment of interest is mysequence and the adapter is ADAPTER. Depending on the read length, you will get reads that look like this:

mysequen
mysequenceADAP
mysequenceADAPTER
mysequenceADAPTERsomethingelse

Use Cutadapt’s -a ADAPTER option to remove this type of adapter. This will be the result:

mysequen
mysequence
mysequence
mysequence

As this example shows, Cutadapt allows regular 3’ adapters to occur in full anywhere within the read (preceeded and/or succeeded by zero or more bases), and also partially degraded at the 3’ end. Cutadapt deals with 3’ adapters by removing the adapter itself and any sequence that may follow. As a consequence, a sequence that starts with an adapter, like this, will be trimmed to an empty read:

ADAPTERsomething

By default, empty reads are kept and will appear in the output. If you do not want this, use the --minimum-length/-m filtering option.

Regular 5’ adapters

Note

Unless your adapter may also occur in a degraded form, you probably want to use an anchored 5’ adapter.

A 5’ adapter is a piece of DNA ligated to the 5’ end of the DNA fragment of interest. For this type of adapter to be found, the adapter sequence needs to either appear in full somewhere within the read (internal match) or at the start (5’ end) of it, where in the latter case also partial occurrences are allowed. In all cases, the adapter itself and the sequence preceding it is removed.

Assume your fragment of interest is mysequence and the adapter is ADAPTER. The reads may look like this:

ADAPTERmysequence
DAPTERmysequence
TERmysequence
somethingADAPTERmysequence

All the above sequences are trimmed to mysequence when you use -g ADAPTER. As with 3’ adapters, the resulting read may have a length of zero when the sequence ends with the adapter. For example, the read

somethingADAPTER

will be empty after trimming.

Anchored 5’ adapters

In many cases, the above behavior is not really what you want for trimming 5’ adapters. You may know, for example, that degradation does not occur and that the adapter is also not expected to be within the read. Thus, you always expect the read to look like the first example from above:

ADAPTERsomething

If you want to trim only this type of adapter, use -g ^ADAPTER. The ^ is supposed to indicate the the adapter is “anchored” at the beginning of the read. In other words: The adapter is expected to be a prefix of the read. Note that cases like these are also recognized:

ADAPTER
ADAPT
ADA

The read will simply be empty after trimming.

Be aware that Cutadapt still searches for adapters error-tolerantly and, in particular, allows insertions. So if your maximum error rate is sufficiently high, even this read will be trimmed:

BADAPTERsomething

The B in the beginning is seen as an insertion. If you also want to prevent this from happening, use the option --no-indels to disallow insertions and deletions entirely.

Anchored 3’ adapters

It is also possible to anchor 3’ adapters to the end of the read. This is rarely necessary, but if you have merged, for example, overlapping paired-end reads, then it is useful. Add the $ character to the end of an adapter sequence specified via -a in order to anchor the adapter to the end of the read, such as -a ADAPTER$. The adapter will only be found if it is a suffix of the read, but errors are still allowed as for 5’ adapters. You can disable insertions and deletions with --no-indels.

Anchored 3’ adapters work as if you had reversed the sequence and used an appropriate anchored 5’ adapter.

As an example, assume you have these reads:

mysequenceADAP
mysequenceADAPTER
mysequenceADAPTERsomethingelse

Using -a ADAPTER$ will result in:

mysequenceADAP
mysequence
mysequenceADAPTERsomethingelse

That is, only the middle read is trimmed at all.

Non-internal 5’ and 3’ adapters

The non-internal 5’ and 3’ adapter types disallow internal occurrences of the adapter sequence. This is like a less strict version of anchoring: The adapter must always be at one of the ends of the read, but - unlike anchored adapters - partial occurrences are also ok.

Use -a ADAPTERX (replace ADAPTER with your actual adapter sequence, but use a literal X) to disallow internal matches for a 3’ adapter. Use -g XADAPTER to disallow them for a 5’ adapter. Mnemonic: The X is not allowed to “shift into” the read.

Here are some examples for trimming reads with -a ADAPTERX:

Input read Processed read
mysequenceADAP mysequence
mysequenceADAPTER mysequence
mysequenceADAPTERsomethingelse mysequenceADAPTERsomethingelse

Here are some examples for trimming reads with -g XADAPTER:

Input read Processed read
APTERmysequence mysequence
ADAPTERmysequence mysequence
somethingelseADAPTERmysequence somethingelseADAPTERmysequence

New in version 1.17.

Linked adapters (combined 5’ and 3’ adapter)

If your sequence of interest is “framed” by a 5’ and a 3’ adapter, and you want to remove both adapters, then you may want to use a linked adapter. A linked adapter combines a 5’ and a 3’ adapter. By default, the adapters are not anchored, but in many cases, you should anchor the 5’ adapter by prefixing it with ^.

See the previous sections for what anchoring means.

Note

Cutadapt versions before 2.0 anchored the 5’ adapter within linked adapters automatically even if the initial ^ was not specified. If you have scripts written for Cutadapt versions earlier than 2.0, please add the ^ so that the behavior does not change!

Linked adapters are specified as two sequences separated by ... (three dots):

cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fastq.gz in.fastq.gz

If you anchor an adapter, it will also become marked as being required. If a required adapter cannot be found, the read will not be trimmed at all even if the other adapter occurs. If an adapter is not required, it is optional.

Also, when you use the --discard-untrimmed option (or --trimmed-only) with a linked adapter, then a read is considered to be trimmed only if all required adapters were found.

In the previous example, ADAPTER1 was anchored and therefore required, but ADAPTER2 was optional. Anchoring also ADAPTER2 (and making it required as well) would look like this:

cutadapt -a ^ADAPTER1...ADAPTER2$ -o out.fastq.gz in.fastq.gz

As an example, assume the 5’ adapter is FIRST, the 3’ adapter is SECOND and you have these input reads:

FIRSTmysequenceSECONDextrabases
FIRSTmysequenceSEC
FIRSTmyseque
anotherreadSECOND

Trimming with

cutadapt -a ^FIRST...SECOND -o output.fastq input.fastq

will result in

mysequence
mysequence
myseque
anotherreadSECOND

The 3’ adapter in the last read is not trimmed because the anchored 5’ adapter is required, but missing in the read.

Linked adapters do not work when used in combination with --info-file and --mask-adapter.

New in version 1.10.

New in version 1.13: Ability to anchor the 3’ adapter.

New in version 2.0: The 5’ adapter is no longer anchored by default.

Changing which adapters are required

As described, when you specify a linked adapter with -a, the adapters that are anchored become required, and the non-anchored adapters become optional. To change this, you can instead use -g to specify a linked adapter. In that case, both adapters are required (even if they are not anchored). This type of linked adapter type is especially suited for trimming CRISPR screening reads. For example:

cutadapt -g ADAPTER1...ADAPTER2 -o out.fastq.gz in.fastq.gz

Here, both ADAPTER1 and ADAPTER2 are not anchored, but they are required because -g was used.

The -g option does not cover all cases, so you can also mark each adapter explicitly as required or optional using the trimming parameters required and optional. This is the only way to make an anchored adapter optional. For example, to request that an anchored 5’ adapter (here ADAPTER1) should not be required, you can specify it like this

cutadapt -a "^ADAPTER1;optional...ADAPTER2" -o output.fastq.gz input.fastq.gz

New in version 1.13: Option -g added.

Changed in version 1.15: Option -g requires both adapters.

Linked adapter statistics

For linked adapters, the statistics report contains a line like this:

=== Adapter 1 ===

Sequence: AAAAAAAAA...TTTTTTTTTT; Type: linked; Length: 9+10; Trimmed: 3 times; Half matches: 2

The value for “Half matches” tells you how often only the 5’-side of the adapter was found, but not the 3’-side of it. This applies only to linked adapters with regular (non-anchored) 3’ adapters.

5’ or 3’ adapters

The last type of adapter is a combination of the 5’ and 3’ adapter. You can use it when your adapter is ligated to the 5’ end for some reads and to the 3’ end in other reads. This probably does not happen very often, and this adapter type was in fact originally implemented because the library preparation in an experiment did not work as it was supposed to.

For this type of adapter, the sequence is specified with -b ADAPTER (or use the longer spelling --anywhere ADAPTER). The adapter may appear in the beginning (even degraded), within the read, or at the end of the read (even partially). The decision which part of the read to remove is made as follows: If there is at least one base before the found adapter, then the adapter is considered to be a 3’ adapter and the adapter itself and everything following it is removed. Otherwise, the adapter is considered to be a 5’ adapter and it is removed from the read, but the sequence after it remains.

Here are some examples.

Read before trimming Read after trimming Detected adapter type
MYSEQUENCEADAPTERSOMETHING MYSEQUENCE 3’ adapter
MYSEQUENCEADAPTER MYSEQUENCE 3’ adapter
MYSEQUENCEADAP MYSEQUENCE 3’ adapter
MADAPTER M 3’ adapter
ADAPTERMYSEQUENCE MYSEQUENCE 5’ adapter
PTERMYSEQUENCE MYSEQUENCE 5’ adapter
TERMYSEQUENCE MYSEQUENCE 5’ adapter

Multiple adapter occurrences within a single read

If a single read contains multiple copies of the same adapter, the basic rule is that the leftmost match is used for both 5’ and 3’ adapters. For example, when searching for a 3’ adapter in

cccccADAPTERgggggADAPTERttttt

the read will be trimmed to

ccccc

When the adapter is a 5’ adapter instead, the read will be trimmed to

gggggADAPTERttttt

Adapter-trimming parameters

The adapter-trimming algorithm has a few parameters specific to each adapter that steer how the adapter sequence is found. The command-line options -e and -O set the maximum error rate and minimum overlap parameters (see details in the following sections) for all adapters listed via the -a/-b/-g etc. options. When trimming more than one adapter, it may be necessary to change parameters for each adapter individually. You can do so by adding a semicolon and parameter=value to the end of the adapter sequence, as in -a "ADAPTER;max_error_rate=0.2". Multiple parameters can also be set, as in -a "ADAPTER;max_error_rate=0.2;min_overlap=5". Remember to add the quotation marks; otherwise the shell will interpret the semicolon as a separator between two commands.

The following parameters are supported at the moment:

Parameter Global option Adapter-specific parameter
Maximum error rate -e 0.2
ADAPTER;e=0.2 or
ADAPTER;max_errors=0.2 or
ADAPTER;max_error_rate=0.2
Minimum overlap -O 5
ADAPTER;o=5 or
ADAPTER;min_overlap=5
Allow matches anywhere   ADAPTER;anywhere
Linked adapter required   ADAPTER;required
Linked adapter optional   ADAPTER;optional

Adapter-specific parameters override the global option.

Error tolerance

All searches for adapter sequences are error tolerant. Allowed errors are mismatches, insertions and deletions. For example, if you search for the adapter sequence ADAPTER and the error tolerance is set appropriately (as explained below), then also ADABTER will be found (with 1 mismatch), as well as ADAPTR (with 1 deletion), and also ADAPPTER (with 1 insertion). If insertions and deletions are disabled with --no-indels, then mismatches are the only type of errors.

The level of error tolerance is determined by a maximum error rate, which is 0.1 (=10%) by default. An adapter occurrence is only found if the actual error rate of the match does not exceed the maximum error rate. The actual error rate is computed as the number of errors in the match divided by the length of the matching part of the adapter.

For example, an adapter match of length 8 containing 1 error has an error rate of 1/8=0.125. At the default maximum error rate 0.1, it would not be found, but a match of length 10 containing 1 error has an error rate of 1/10=0.1 and would be found.

Relating the number of errros to the length of the matching part of the adapter is important because Cutadapt allows for partial adapter occurrences (for the non-anchored adapter types). If only the absolute number of errors were used, shorter matches would be favored unfairly. For example, assume an adapter has 30 bases and we allow three errors over that length. If we allowed these three errors even for a partial occurrences of, for example, four bases, we can immediately see that this results in unexpected matches. Using the error rate as a criterion helps to keep sensitivity and specificity roughly the same over the possible lengths of the matches.

The -e option on the command line allows you to change the maximum error rate. If the value is between 0 and 1 (but not 1 exactly), then this sets the maximum error rate directly for all specified adapters. The default is -e 0.1. You can also use the adapter-specific parameter max_error_rate or max_errors or just e to override the default for a single adapter only. Examples: -a "ADAPTER;max_error_rate=0.15", -a "ADAPTER;e=0.15" (the quotation marks are necessary).

Alternatively, you can also specify a value of 1 or greater as the number of allowed errors, which is then converted to a maximum error rate for each adapter individually. For example, with an adapter of length 10, using -e 2 will set the maximum error rate to 0.2 for an adapter of length 10.

The value does not have to be an integer, and if you use an adapter type that allows partial matches, you may want to add 0.5 to the desired number of errors, which achieves that even slightly shorter than full-lengths matches will be allowed at the specified number of errors. In short, if you want to allow two errors, use -e 2.5.

This also works in the adapter-specific parameters. Examples: -a "ADAPTER;e=1", -a "ADAPTER;max_errors=2.5". Note that e, max_error_rate and max_errors are all equivalent and the decision whether a rate or an absolute number is meant is based on whether the given value is less than 1 or not.

The number of errors allowed for a given adapter match length is also shown under the “No. of allowed errors” heading in the report that Cutadapt prints:

Sequence: 'SOMEADAPTER'; Length: 11; Trimmed: 2 times.

No. of allowed errors:
0-9 bp: 0; 10-11 bp: 1

This tells us: For match lengths of 0-9 bases, zero errors are allowed and for matches of length 10-11 bases, one error is allowed.

See also the section on details of the alignment algorithm.

N wildcard characters

Any N wildcard characters in the adapter sequence are skipped when computing the error rate. That is, they do not contribute to the length of a match. For example, the adapter sequence ACGTACNNNNNNNNGTACGT has a length of 20, but only 12 non-N-characters. At a maximum error rate of 0.1, only one error is allowed if this sequence is found in full in a read because 12·0.1=1.2, which is 1 when rounded down.

This is done because N bases cannot contribute to the number of errors. In previous versions, N wildcard characters did contribute to the match length, but this artificially inflates the number of allowed errors. For example, an adapter like N{18}CC (18 N wildcards followed by CC) would effectively match anywhere because the default error rate of 0.1 would allow for two errors, but there are only two non-N bases in the particular adapter.

However, even in previous versions, the location with the greatest number of matching bases is chosen as the best location for an adapter, so in many cases the adapter would still be placed properly.

Minimum overlap (reducing random matches)

Since Cutadapt allows partial matches between the read and the adapter sequence, short matches can occur by chance, leading to erroneously trimmed bases. For example, roughly 25% of all reads end with a base that is identical to the first base of the adapter. To reduce the number of falsely trimmed bases, the alignment algorithm requires that, by default, at least three bases match between adapter and read.

This minimum overlap length can be changed globally (for all adapters) with the parameter --overlap (or its short version -O). Alternatively, use the adapter-specific parameter min_overlap to change it for a single adapter only. Example: -a "ADAPTER;min_overlap=5" (the quotation marks are necessary).

If a read contains a partial adapter sequence shorter than the minimum overlap length, no match will be found (and therefore no bases are trimmed).

Requiring at least three bases to match is quite conservative. Even if no minimum overlap was required, we can compute that we lose only about 0.44 bases per read on average, see Section 2.3.3 in my thesis. With the default minimum overlap length of 3, only about 0.07 bases are lost per read.

When choosing an appropriate minimum overlap length, take into account that true adapter matches are also lost when the overlap length is higher than zero, reducing Cutadapt’s sensitivity.

Allowing partial matches at both ends

The regular 5’ and 3’ adapter types allow partial adapter occurrences only at the 5’ and 3’ end, respectively. To allow partial matches at both ends, you can use the anywhere adapter-specific parameter.

A 3’ adapter specified via -a ADAPTER will be found even when it occurs partially at the 3’ end, as in mysequenceADAPT. However, it will by default not be found if it occurs partially at the 5’ end, as in APTERmysequence. To find the adapter in both cases, specify the adapter as -a "ADAPTER;anywhere".

Similarly, for a 5’ adapter specified via -g ADAPTER, partial matches at the 3’ end are not found, as in mysequenceADAPT. To allow partial matches at both ends, use -g "ADAPTER;anywhere".

Note

With anywhere, partial matches at the end that is usually not allowed to be matched will result in empty reads! This means that short random matches have a much greater detrimental effect and you should increase the minimum overlap length.

Searching reverse complements

Note

Option --revcomp is added on a tentative basis. Its behaviour may change in the next releases.

By default, Cutadapt expects adapters to be given in the same orientation (5’ to 3’) as the reads. That is, neither reads nor adapters are reverse-complemented.

To change this, use option --revcomp or its abbreviation --rc. If given, Cutadapt searches both the read and its reverse complement for adapters. If the reverse complemented read yields a better match, then that version of the read is kept. That is, the output file will contain the reverse-complemented sequence. This can be used to “normalize” read orientation/strandedness.

To determine which version of the read yields the better match, the full adapter search (possibly multiple rounds if --times is used) is done independently on both versions, and the version that results in the higher number of matching nucleotides is considered to be the better one.

The name of a reverse-complemented read is changed by adding a space and rc to it. (Please file an issue if you would like this to be configurable.)

The report will show the number of reads that were reverse-complemented, like this:

Total reads processed:  60
Reads with adapters:    50 (83.3%)
Reverse-complemented:   20 (33.3%)

Here, 20 reverse-complemented reads contain an adapter and 50 - 20 = 30 reads that did not need to be reverse-complemented contain an adapter.

Option --revcomp is currently available only for single-end data.

New in version 2.8.

Specifying adapter sequences

Wildcards

All IUPAC nucleotide codes (wildcard characters) are supported. For example, use an N in the adapter sequence to match any nucleotide in the read, or use -a YACGT for an adapter that matches both CACGT and TACGT. The wildcard character N is useful for trimming adapters with an embedded variable barcode:

cutadapt -a ACGTAANNNNTTAGC -o output.fastq input.fastq

Even the X wildcard that does not match any nucleotide is supported. If used as in -a ADAPTERX or -g XADAPTER, it acquires a special meaning for and disallows internal adapter matches.

Wildcard characters are by default only allowed in adapter sequences and are not recognized when they occur in a read. This is to avoid matches in reads that consist of many (often low-quality) N bases. Use --match-read-wildcards to enable wildcards also in reads.

Use the option -N to disable interpretation of wildcard characters even in the adapters. If wildcards are disabled entirely, that is, when you use -N and do not use --match-read-wildcards, then Cutadapt compares characters by their ASCII value. Thus, both the read and adapter can be arbitrary strings (such as SEQUENCE or ADAPTER as used here in the examples).

Repeated bases

If you have many repeated bases in the adapter sequence, such as many N s or many A s, you do not have to spell them out. For example, instead of writing ten A in a row (AAAAAAAAAA), write A{10} instead. The number within the curly braces specifies how often the character that preceeds it will be repeated. This works also for IUPAC wildcard characters, as in N{5}.

It is recommended that you use quotation marks around your adapter sequence if you use this feature. For poly-A trimming, for example, you would write:

cutadapt -a "A{100}" -o output.fastq input.fastq

Modifying reads

This section describes in which ways reads can be modified other than adapter removal.

--action changes what is done when an adapter is found

The --action option can be used to change what is done when an adapter match is found in a read.

The default is --action=trim, which will remove the adapter and the sequence before or after it from the read. For 5’ adapters, the adapter and the sequence preceding it is removed. For 3’ adapters, the adapter and the sequence following it is removed. Since linked adapters are a combination of a 5’ and 3’ adapter, in effect only the sequence between the 5’ and the 3’ adapter matches is kept.

With --action=retain, the read is trimmed, but the adapter sequence itself is not removed. Up- and downstream sequences are removed in the same way as for the trim action. For linked adapters, both adapter sequences are kept.

Note

Because it is somewhat unclear what should happen, --action=retain can at the moment not be combined with --times (multiple rounds of adapter removal).

Use --action=none to not change the read even if there is a match. This is useful because the statistics will still be updated as before and because the read will still be considered “trimmed” for the read filtering options. Combining this with --untrimmed-output, for example, can be used to copy reads without adapters to a different file. Other read modification options, if used, may still change the read.

Use --action=mask to write N characters to those parts of the read that would otherwise have been removed.

Use --action=lowercase to change to lowercase those parts of the read that would otherwise have been removed. The rest is converted to uppercase.

New in version 3.1: The retain action.

Removing a fixed number of bases

By using the --cut option or its abbreviation -u, it is possible to unconditionally remove bases from the beginning or end of each read. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end.

For example, to remove the first five bases of each read:

cutadapt -u 5 -o trimmed.fastq reads.fastq

To remove the last seven bases of each read:

cutadapt -u -7 -o trimmed.fastq reads.fastq

The -u/--cut option can be combined with the other options, but the --cut is applied before any adapter trimming.

Quality trimming

The -q (or --quality-cutoff) parameter can be used to trim low-quality ends from reads. If you specify a single cutoff value, the 3’ end of each read is trimmed:

cutadapt -q 10 -o output.fastq input.fastq

For Illumina reads, this is sufficient as their quality is high at the beginning, but degrades towards the 3’ end.

It is also possible to also trim from the 5’ end by specifying two comma-separated cutoffs as 5’ cutoff,3’ cutoff. For example,

cutadapt -q 15,10 -o output.fastq input.fastq

will quality-trim the 5’ end with a cutoff of 15 and the 3’ end with a cutoff of 10. To only trim the 5’ end, use a cutoff of 0 for the 3’ end, as in -q 15,0.

Quality trimming is done before any adapter trimming.

By default, quality values are assumed to be encoded as ascii(phred quality + 33). Nowadays, this should always be the case. Some old Illumina FASTQ files encode qualities as ascii(phred quality + 64). For those, you must add --quality-base=64 to the command line.

A description of the quality-trimming algorithm is also available. The algorithm is the same as used by BWA.

Quality trimming of reads using two-color chemistry (NextSeq)

Some Illumina instruments use a two-color chemistry to encode the four bases. This includes the NextSeq and the NovaSeq. In those instruments, a ‘dark cycle’ (with no detected color) encodes a G. However, dark cycles also occur when sequencing “falls off” the end of the fragment. The read then contains a run of high-quality, but incorrect “G” calls at its 3’ end.

Since the regular quality-trimming algorithm cannot deal with this situation, you need to use the --nextseq-trim option:

cutadapt --nextseq-trim=20 -o out.fastq input.fastq

This works like regular quality trimming (where one would use -q 20 instead), except that the qualities of G bases are ignored.

New in version 1.10.

Shortening reads to a fixed length

To shorten each read down to a certain length, use the --length option or the short version -l:

cutadapt -l 10 -o output.fastq.gz input.fastq.gz

This shortens all reads from input.fastq.gz down to 10 bases. The removed bases are those on the 3’ end.

If you want to remove a fixed number of bases from each read, use the –cut option instead.

Modifying read names

If you feel the need to modify the names of processed reads, some of the following options may be useful.

Use -y or --suffix to append a text to read names. The given string can contain the placeholder {name}, which will be replaced with the name of the adapter found in that read. For example, writing

cutadapt -a adapter1=ACGT -y ' we found {name}' input.fastq

changes a read named read1 to read1 we found adapter1 if the adapter ACGT was found. The options -x/--prefix work the same, but the text is added in front of the read name. For both options, spaces need to be specified explicitly, as in the above example. If no adapter was found in a read, the text no_adapter is inserted for {name}.

In order to remove a suffix of each read name, use --strip-suffix.

Some old 454 read files contain the length of the read in the name:

>read1 length=17
ACGTACGTACAAAAAAA

If you want to update this to the correct length after trimming, use the option --length-tag. In this example, this would be --length-tag 'length='. After trimming, the read would perhaps look like this:

>read1 length=10
ACGTACGTAC

Read modification order

The read modifications described above are applied in the following order to each read. Steps not requested on the command-line are skipped.

  1. Unconditional base removal with --cut
  2. Quality trimming (-q)
  3. Adapter trimming (-a, -b, -g and uppercase versions)
  4. Read shortening (--length)
  5. N-end trimming (--trim-n)
  6. Length tag modification (--length-tag)
  7. Read name suffix removal (--strip-suffix)
  8. Addition of prefix and suffix to read name (-x/--prefix and -y/--suffix)
  9. Replace negative quality values with zero (zero capping)

Filtering reads

By default, all processed reads, no matter whether they were trimmed or not, are written to the output file specified by the -o option (or to standard output if -o was not provided). For paired-end reads, the second read in a pair is always written to the file specified by the -p option.

The options described here make it possible to filter reads by either discarding them entirely or by redirecting them to other files. When redirecting reads, the basic rule is that each read is written to at most one file. You cannot write reads to more than one output file.

Filters are applied to all processed reads, no matter whether they have been modified by adapter- or quality trimming.

--minimum-length LENGTH or -m LENGTH

Discard processed reads that are shorter than LENGTH.

If you do not use this option, reads that have a length of zero (empty reads) are kept in the output. Some downstream tools may have problems with zero-length sequences. In that case, specify at least -m 1.

--too-short-output FILE
Instead of discarding the reads that are too short according to -m, write them to FILE (in FASTA/FASTQ format).
--maximum-length LENGTH or -M LENGTH
Discard processed reads that are longer than LENGTH.
--too-long-output FILE
Instead of discarding reads that are too long (according to -M), write them to FILE (in FASTA/FASTQ format).
--untrimmed-output FILE
Write all reads without adapters to FILE (in FASTA/FASTQ format) instead of writing them to the regular output file.
--discard-trimmed
Discard reads in which an adapter was found.
--discard-untrimmed
Discard reads in which no adapter was found. This has the same effect as specifying --untrimmed-output /dev/null.

The options --too-short-output and --too-long-output are applied first. This means, for example, that a read that is too long will never end up in the --untrimmed-output file when --too-long-output was given, no matter whether it was trimmed or not.

The options --untrimmed-output, --discard-trimmed and -discard-untrimmed are mutually exclusive.

The following filtering options do not have a corresponding option for redirecting reads. They always discard those reads for which the filtering criterion applies.

--max-n COUNT_or_FRACTION
Discard reads with more than COUNT N bases. If COUNT_or_FRACTION is a number between 0 and 1, it is interpreted as a fraction of the read length
--max-expected-errors ERRORS or --max-ee ERRORS
Discard reads with more than ERRORS expected errors. The number of expected errors is computed as described in Edgar et al. (2015), (Section 2.2).
--discard-casava
Discard reads that did not pass CASAVA filtering. Illumina’s CASAVA pipeline in version 1.8 adds an is_filtered header field to each read. Specifying this option, the reads that did not pass filtering (these are the reads that have a Y for is_filtered) will be discarded. Reads for which the header cannot be recognized are kept.

Trimming paired-end reads

Cutadapt supports trimming of paired-end reads. To enable this, provide two input files and a second output file with the -p option (this is the short form of --paired-output). This is the basic command line syntax:

cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq

Here, the input reads are in reads.1.fastq and reads.2.fastq, and the result will be written to out.1.fastq and out.2.fastq.

In paired-end mode, the options -a, -b, -g and -u that also exist in single-end mode are applied to the forward reads only. To modify the reverse read, these options have uppercase versions -A, -B, -G and -U that work just like their counterparts. In the example above, ADAPTER_FWD will therefore be trimmed from the forward reads and ADAPTER_REV from the reverse reads.

Single-end/R1 option Corresponding option for R2
--adapter, -a -A
--front, -g -G
--anywhere, -b -B
--cut, -u -U
--output, -o --paired-output, -p

In paired-end mode, Cutadapt checks whether the input files are properly paired. An error is raised if one of the files contains more reads than the other or if the read names in the two files do not match. The read name comparison ignores a trailing /1 or /2 to allow processing some old Illumina paired-end files.

In some cases, it works to run Cutadapt twice in single-end mode on the input files, but we recommend against it as this skips the consistency checks that Cutadapt can do otherwise.

Also, as soon as you start to use one of the filtering options that discard reads, it is mandatory you process both files at the same time to make sure that the output files are kept synchronized. If a read is removed from one of the files, Cutadapt will always ensure that it is also removed from the other file.

The following command-line options are applied to both reads:

  • -q (along with --quality-base)
  • --times applies to all the adapters given
  • --trim-n
  • --action
  • --length
  • --length-tag
  • --prefix, --suffix

The following limitations still exist:

  • The --info-file, --rest-file and --wildcard-file options write out information only from the first read.

Filtering paired-end reads

The filtering options listed above can also be used when trimming paired-end data.

Importantly, Cutadapt always discards both reads of a pair if it determines that the pair should be discarded. This ensures that the reads in the output files are in sync. (If you don’t want or need this, you can run Cutadapt separately on the R1 and R2 files.)

The same applies also to the options that redirect reads to other files if they fulfill a filtering criterion, such as --too-short-output/--too-short-paired-output. That is, the reads are always sent in pairs to these alternative output files.

The --pair-filter option determines how to combine the filters for R1 and R2 into a single decision about the read pair.

The default is --pair-filter=any, which means that a read pair is discarded (or redirected) if one of the reads (R1 or R2) fulfills the filtering criterion. As an example, if option --minimum-length=20 is used and paired-end data is processed, a read pair is discarded if at least one of the reads is shorter than 20 nt.

With --pair-filter=both, you can require that filtering criteria must apply to both reads in order for a read pair to be discarded.

Finally, --pair-filter=first will make a decision about the read pair by inspecting whether the filtering criterion applies to the first read, ignoring the second read.

The following table describes the effect for some filtering options.

Filtering option With --pair-filter=any, the pair is discarded if … With --pair-filter=both, the pair is discarded if …
--minimum-length one of the reads is too short both reads are too short
--maximum-length one of the reads is too long both reads are too long
--discard-trimmed one of the reads contains an adapter both reads contain an adapter
--discard-untrimmed one of the reads does not contain an adapter both reads do not contain an adapter
--max-n one of the reads contains too many N bases both reads contain too many N bases

Note

As an exception, when you specify adapters only for R1 (-a/-g/-b) or only for R2 (-A/-G/-B), then the --pair-filter mode for --discard-untrimmed is forced to be both (and accordingly, also for the --untrimmed-(paired-)output options).

Otherwise, with the default --pair-filter=any setting, all pairs would be considered untrimmed because it would always be the case that one of the reads in the pair does not contain an adapter.

These are the paired-end specific filtering and output options:

--minimum-length LENGTH1:LENGTH2 or -m LENGTH1:LENGTH2
When trimming paired-end reads, the minimum lengths for R1 and R2 can be specified separately by separating them with a colon (:). If the colon syntax is not used, the same minimum length applies to both reads, as discussed above. Also, one of the values can be omitted to impose no restrictions. For example, with -m 17:, the length of R1 must be at least 17, but the length of R2 is ignored.
--maximum-length LENGTH1:LENGTH2 or -M LENGTH1:LENGTH2
Maximum lengths can also be specified separately, see the explanation of -m above.
--paired-output FILE or -p FILE
Write the second read of each processed pair to FILE (in FASTA/FASTQ format).
--untrimmed-paired-output FILE
Used together with --untrimmed-output. The second read in a pair is written to this file when the processed pair was not trimmed.
--too-short-paired-output FILE
Write the second read in a pair to this file if pair is too short. Use together with --too-short-output.
--too-long-paired-output FILE
Write the second read in a pair to this file if pair is too long. Use together with --too-long-output.
--pair-filter=(any|both|first)
Which of the reads in a paired-end read have to match the filtering criterion in order for it to be filtered.

Note that the option names can be abbreviated as long as it is clear which option is meant (unique prefix). For example, instead of --untrimmed-output and --untrimmed-paired-output, you can write --untrimmed-o and --untrimmed-p.

New in version 1.18: --pair-filter=first

Paired adapters (dual indices)

Note

This feature has been added on a provisional basis. It may still change. For example, Cutadapt may require that the adapters from the R1 and the R2 sets have matching names, which would allow for better error checking.

When processing paired-end data, Cutadapt has two sets of adapters to work with: The ones that are to be found and removed in the forward read (R1), specified with -a/-g/-b, and the ones to be found and removed in the reverse read (R2), specified with -A/-G/-B.

Normally, the program looks at the R1 and R2 reads independently. That is, the best matching R1 adapter is removed from R1 and the best matching R2 adapter is removed from R2.

To change this, the option --pair-adapters can be used. It causes each R1 adapter to be paired up with its corresponding R2 adapters. The first R1 adapter will be paired up with the first R2 adapter, and so on. The adapters are then always removed in pairs from a read pair. It is an error if the number of provided adapters is not identical for the R1 and R2 sets.

This option was added to aid in demultiplexing Illumina libraries that contain unique dual indexes (UDI). This scheme, also called “non-redundant indexing”, uses 96 unique i5 indices and 96 unique i7 indices, which are only used in pairs, that is, the first i5 index is always used with the first i7 index and so on.

Note

If the adapters do not come in pairs, but all combinations are possible, see the section about combinatorial demultiplexing.

An example:

cutadapt --pair-adapters -a AAAAA -a GGGG -A CCCCC -a TTTT -o out.1.fastq -p out.2.fastq in.1.fastq in.2.fastq

Here, the adapter pairs are (AAAAA, CCCCC) and (GGGG, TTTT). That is, paired-end reads will only be trimmed if either

  • AAAAA is found in R1 and CCCCC is found in R2,
  • or GGGG is found in R1 and TTTT is found in R2.

The --pair-adapters option can be used also when demultiplexing.

There is one limitation of the algorithm at the moment: The program looks for the best-matching R1 adapter first and then checks whether the corresponding R2 adapter can be found. If not, the read pair remains unchanged. However, it is in theory possible that a different R1 adapter that does not fit as well would have a partner that can be found. Some read pairs may therefore remain untrimmed.

New in version 2.1.

Interleaved paired-end reads

Cutadapt supports reading and writing paired-end reads from a single FASTQ file in which the entries for the first and second read from each pair alternate. The first read in each pair comes before the second. This is called “interleaved” format. Enable this file format by adding the --interleaved option to the command-line. Then, if you provide only a single file where usually two would be expected, reads are automatically read or written interleaved.

For example, to read interleaved from reads.fastq and to write interleaved to trimmed.fastq:

cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.fastq reads.fastq

In the following example, the input reads.fastq is interleaved, but output is written to two files trimmed.1.fastq and trimmed.2.fastq:

cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq -p trimmed.2.fastq reads.fastq

Reading two-file input and writing interleaved is also possible by providing a second input file:

cutadapt --interleaved -q 20 -a ACGT -A TGCA -o trimmed.1.fastq reads.1.fastq reads.2.fastq

The following options also supported interleaved output:

* ``--untrimmed-output`` (omit ``--untrimmed-paired-output``)
* ``--too-short-output`` (omit ``--too-short-paired-output``)
* ``--too-long-output`` (omit ``--too-long-paired-output``)

If you omit --interleaved but trim paired-end files, the above options must be used in pairs.

Cutadapt will detect if an input file is not properly interleaved by checking whether read names match and whether the file contains an even number of entries.

Trimming paired-end reads separately

Warning

Trimming paired-end data in this way is not recommended as it bypasses all paired-end error-checking, such as checking whether the number of reads is the same in both files. You should use the normal paired-end trimming mode with the -o/--p options described above.

If you do not use any of the filtering options that discard reads, such as --discard, --minimum-length or --maximum-length, you can run Cutadapt on each file separately:

cutadapt -a ADAPTER_FWD -o trimmed.1.fastq.gz reads1.fastq.gz
cutadapt -a ADAPTER_REV -o trimmed.2.fastq.gz reads2.fastq.gz

You can use the options that are listed under ‘Additional modifications’ in Cutadapt’s help output without problems. For example, if you want to quality-trim the first read in each pair with a threshold of 10, and the second read in each pair with a threshold of 15, then the commands could be:

cutadapt -q 10 -a ADAPTER_FWD -o trimmed.1.fastq reads1.fastq
cutadapt -q 15 -a ADAPTER_REV -o trimmed.2.fastq reads2.fastq

Note

Previous Cutadapt versions (up to 1.18) had a “legacy mode” that was activated under certain conditions and in which the read-modifying options such as -q would only apply to the forward/R1 reads. This mode no longer exists.

Multiple adapters

It is possible to specify more than one adapter sequence by using the options -a, -b and -g more than once. Any combination is allowed, such as five -a adapters and two -g adapters. Each read will be searched for all given adapters, but only the best matching adapter is removed. (But it is possible to trim more than one adapter from each read). This is how a command may look to trim one of two possible 3’ adapters:

cutadapt -a TGAGACACGCA -a AGGCACACAGGG -o output.fastq input.fastq

The adapter sequences can also be read from a FASTA file. Instead of giving an explicit adapter sequence, you need to write file: followed by the name of the FASTA file:

cutadapt -a file:adapters.fasta -o output.fastq input.fastq

All of the sequences in the file adapters.fasta will be used as 3’ adapters. The other adapter options -b and -g also support this. The file: syntax can be combined with the regular way of specifying an adapter. But no matter how you specify multiple adapter sequences, remember that only the best matching adapter is trimmed from each read.

When Cutadapt has multiple adapter sequences to work with, either specified explicitly on the command line or via a FASTA file, it decides in the following way which adapter should be trimmed:

  • All given adapter sequences are matched to the read.
  • Adapter matches where the overlap length (see the -O parameter) is too small or where the error rate is too high (-e) are removed from further consideration.
  • Among the remaining matches, the one with the greatest number of matching bases is chosen.
  • If there is a tie, the first adapter wins. The order of adapters is the order in which they are given on the command line or in which they are found in the FASTA file.

If your adapter sequences are all similar and differ only by a variable barcode sequence, you can use a single adapter sequence instead that contains wildcard characters.

If you want to search for a combination of a 5’ and a 3’ adapter, you may want to provide them as a single so-called “linked adapter” instead.

Named adapters

Cutadapt reports statistics for each adapter separately. To identify the adapters, they are numbered and the adapter sequence is also printed:

=== Adapter 1 ===

Sequence: AACCGGTT; Length 8; Trimmed: 5 times.

If you want this to look a bit nicer, you can give each adapter a name in this way:

cutadapt -a My_Adapter=AACCGGTT -o output.fastq input.fastq

The actual adapter sequence in this example is AACCGGTT and the name assigned to it is My_Adapter. The report will then contain this name in addition to the other information:

=== Adapter 'My_Adapter' ===

Sequence: TTAGACATATCTCCGTCG; Length 18; Trimmed: 5 times.

When adapters are read from a FASTA file, the sequence header is used as the adapter name.

Adapter names are also used in column 8 of info files.

Demultiplexing

Cutadapt supports demultiplexing, which means that reads are written to different output files depending on which adapter was found in them. To use this, include the string {name} in the name of the output file and give each adapter a name. The path is then interpreted as a template and each trimmed read is written to the path in which {name} is replaced with the name of the adapter that was found in the read. Reads in which no adapter was found will be written to a file in which {name} is replaced with unknown.

Example:

cutadapt -a one=TATA -a two=GCGC -o trimmed-{name}.fastq.gz input.fastq.gz

This command will create the three files demulti-one.fastq.gz, demulti-two.fastq.gz and demulti-unknown.fastq.gz.

More realistically, your “adapters” would actually be barcode sequences that you will want to provide in a FASTA file. Here is a made-up example for such a barcodes.fasta file:

>barcode01
^TTAAGGCC
>barcode02
^TAGCTAGC
>barcode03
^ATGATGAT

Our barcodes are located at the 5’ end of the R1 read, so we made sure to use anchored 5’ adapters by prefixing each sequence with the ^ character. We will then use -g file:barcodes.fasta, where the -g option specifies that our adapters are 5’ adapters.

These barcode sequences have a length of 8, which means that Cutadapt would not allow any errors when matching them: The default is to allow 10% errors, but 10% of 8 is 0.8, which is rounded down to 0. To allow one error, we increase the maximum error rate to 15% with -e 0.15. Finally, we also use --no-indels because we don’t want to allow insertions or deletions. Also, with the --no-indels option, Cutadapt can use a different algorithm and demultiplexing will be many times faster. Here is the final command:

cutadapt -e 0.15 --no-indels -g file:barcodes.fasta -o "trimmed-{name}.fastq.gz" input.fastq.gz

Demultiplexing is also supported for paired-end data if you provide the {name} template in both output file names (-o and -p). Example:

cutadapt -e 0.15 --no-indels -g file:barcodes.fasta -o trimmed-{name}.1.fastq.gz -p trimmed-{name}.2.fastq.gz input.1.fastq.gz input.2.fastq.gz

Paired-end demultiplexing always uses the adapter matches of the first read to decide where a read should be written. If adapters for read 2 are given (-A/-G), they are detected and removed as normal, but these matches do not influence where the read pair is written. This is to ensure that read 1 and read 2 are always synchronized.

To demultiplex using a barcode that is located on read 2, you can swap the roles of R1 and R2 for both the input and output files

cutadapt -e 0.15 --no-indels -g file:barcodes.fasta -o trimmed-{name}.2.fastq.gz -p trimmed-{name}.1.fastq.gz input.2.fastq.gz input.1.fastq.gz

If you do this in a script or pipeline, it may be a good idea to add a comment to clarify that this reversal of R1 and R2 is intended.

More advice on demultiplexing:

  • You can use --untrimmed-output to change the name of the output file that receives the untrimmed reads (those in which no barcode could be found).
  • Similarly, you can use --untrimmed-paired-output to change the name of the output file that receives the untrimmed R2 reads.
  • If you want to demultiplex, but keep the barcode in the reads, use the option --action=none.
Demultiplexing paired-end reads with combinatorial dual indexes

Illumina’s combinatorial dual indexing strategy uses a set of indexed adapters on R1 and another one on R2. Unlike unique dual indexes (UDI), all combinations of indexes are possible.

For demultiplexing this type of data (“combinatorial demultiplexing”), it is necessary to write each read pair to an output file depending on the adapters found on R1 and R2.

Doing this with Cutadapt is similar to doing normal demultiplexing as described above, but you need to use {name1}} and {name2} in both output file name templates. For example:

cutadapt \
    -e 0.15 --no-indels \
    -g file:barcodes_fwd.fasta \
    -G file:barcodes_rev.fasta \
    -o {name1}-{name2}.1.fastq.gz -p {name1}-{name2}.2.fastq.gz \
    input.1.fastq.gz input.2.fastq.gz

The {name1} will be replaced with the name of the best-matching R1 adapter and {name2}} will be replaced with the name of the best-matching R2 adapter.

If there was no match of an R1 adapter, {name1} is set to “unknown”, and if there is no match of an R2 adapter, {name2} is set to “unknown”. To discard read pairs for which one or both adapters could not be found, use --discard-untrimmed.

The --untrimmed-output and --untrimmed-paired-output options cannot be used.

Read the demultiplexing section for how to choose the error rate etc. Also, the tips below about how to speed up demultiplexing apply even with combinatorial demultiplexing.

When doing the above, you will end up with lots of files named first-second.x.fastq.gz, where first is the name of the first indexed adapter and second is the name of the second indexed adapter, and x is 1 or 2. Each indexed adapter combination may correspond to a sample name and you may want to name your files according to the sample name, not the name of the adapters. Cutadapt does not have built-in functionality to achieve this, but you can use an external tool such as mmv (“multiple move”). First, create a list of patterns in patterns.txt:

fwdindex1-revindex1.[12].fastq.gz sampleA.#1.fastq.gz
fwdindex1-revindex2.[12].fastq.gz sampleB.#1.fastq.gz
fwdindex1-revindex3.[12].fastq.gz sampleC.#1.fastq.gz
fwdindex2-revindex1.[12].fastq.gz sampleD.#1.fastq.gz
fwdindex2-revindex2.[12].fastq.gz sampleE.#1.fastq.gz
...

Here, fwdindex1/revindex1 etc. are the names of indexes, and sampleA etc. are your sample names. Then rename all files at once with

mmv < patterns.txt

New in version 2.4.

Speeding up demultiplexing

Finding many adapters/barcodes simultaneously (which is what demultiplexing in Cutadapt is about), can be sped up tremendously by using the right options since Cutadapt will then be able to create an index of the barcode sequences instead of checking for each barcode separately. Currently, the following conditions need to be met in order for index creation to be enabled:

  • The barcodes/adapters must be anchored 5’ adapters (-g ^ADAPTER) or anchored 3’ adapters (-a ADAPTER$). If you use file: to read in the adapter sequences from a FASTA file, remember to add the ^ or $ to each sequence in the FASTA file.
  • The maximum error rate (-e) must be set such that at most 2 errors are allowed, so use -e 0, -e 1 or -e 2.
  • No IUPAC wildcards must be used in the barcode/adapter. Also, you cannot use the option --match-read-wildcards.

An index will be built for all the adapters that fulfill these criteria if there are at least two of them. You can provide additional adapters/barcodes, and they will just not be included in the index. Whether an index is created or not should not affect the results, only how fast you get them.

To see whether an index is created, look for a message like this in the first few lines of Cutadapt’s output:

Building index of 23 adapters ...

Hopefully some of the above restrictions will be lifted in the future.

New in version 1.15: Demultiplexing of paired-end data.

New in version 2.0: Added ability to use an index of adapters for speeding up demultiplexing

New in version An: index can be built even when indels are allowed (that is, --no-indels is no longer required).

Demultiplexing paired-end reads in mixed orientation

For some protocols, the barcode will be located either on R1 or on R2 depending on the orientation in which the DNA fragment was sequenced.

For example, the read layout could be either this

R1: barcode-forwardprimer-sequence  R2: reverseprimer-sequence

or this

R1: reverseprimer-sequence  R2: barcode-forwardprimer-sequence

To demultiplex such data with Cutadapt, choose one of the orientations first and demultiplex the reads as if only that existed in the data, using a command like this

cutadapt -g file:barcodes.fasta \
    -o round1-{name}.R1.fastq.gz \
    -p round1-{name}.R2.fastq.gz \
    R1.fastq.gz R2.fastq.gz

Then all the read pairs in which no barcode could be found will end up in round1-unknown.R1.fastq.gz and round1-unknown.R2.fastq.gz. This will also include the pairs in which the barcode was not actually in R1, but in R2. To demultiplex these reads as well, run Cutadapt a second time with those “unknown” files as input, but also reverse the roles of R1 and R2

cutadapt -g file:barcodes.fasta \
    -o round2-{name}.R2.fastq.gz \
    -p round2-{name}.R1.fastq.gz \
    round1-unknown.R2.fastq.gz round1-unknown.R1.fastq.gz

Trimming more than one adapter from each read

By default, at most one adapter sequence is removed from each read, even if multiple adapter sequences were provided. This can be changed by using the --times option (or its abbreviated form -n). Cutadapt will then search for all the given adapter sequences repeatedly, either until no adapter match was found or until the specified number of rounds was reached.

As an example, assume you have a protocol in which a 5’ adapter gets ligated to your DNA fragment, but it’s possible that the adapter is ligated more than once. So your sequence could look like this:

ADAPTERADAPTERADAPTERmysequence

To be on the safe side, you assume that there are at most five copies of the adapter sequence. This command can be used to trim the reads correctly:

cutadapt -g ^ADAPTER -n 5 -o output.fastq.gz input.fastq.gz

To search for a combination of a 5’ and a 3’ adapter, have a look at the support for “linked adapters” instead, which works better for that particular case because it is allows you to require that the 3’ adapter is trimmed only when the 5’ adapter also occurs, and it cannot happen that the same adapter is trimmed twice.

Before Cutadapt supported linked adapters, the --times option was the recommended way to search for 5’/3’ linked adapters. For completeness, we describe how it was done. For example, when the 5’ adapter is FIRST and the 3’ adapter is SECOND, then the read could look like this:

FIRSTmysequenceSECOND

That is, the sequence of interest is framed by the 5’ and the 3’ adapter. The following command would be used to trim such a read:

cutadapt -g ^FIRST -a SECOND -n 2 ...

Illumina TruSeq

Illumina makes their adapter sequences available in the Illumina Adapter Sequences Document.

As an example for how to use that information with Cutadapt, we show how to trim TruSeq adapters. The document gives the adapter sequence for read 1 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and for read 2 as AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT. When using Cutadapt, this means you should trim your paired-end data as follows:

cutadapt
-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o trimmed.R1.fastq.gz -p trimmed.R2.fastq.gz reads.R1.fastq.gz reads.R2.fastq.gz

See also the section about paired-end adapter trimming above.

Keep in mind that Cutadapt removes the adapter that it finds and also the sequence following it, so even if the actual adapter sequence that is used in a protocol is longer than that (and possibly contains a variable index), it is sufficient to specify a prefix of the sequence(s).

Note

Previous versions of this document also recommended using AGATCGGAAGAGC as adapter sequence for both read 1 and read 2, but you should avoid doing so as that sequence occurs multiple times in the human genome.

Some older information is also available in the document Illumina TruSeq Adapters De-Mystified, but keep in mind that it does not cover newer protocols.

Under some circumstances, you may want to consider not trimming adapters at all. For example, a good library prepared for exome, genome or transcriptome sequencing should contain very few reads with adapters anyway. Also, some read mapping programs including BWA-MEM and STAR will soft-clip bases at the 3’ ends of reads that do not match the reference, which will take care of adapters implicitly.

Warning about incomplete adapter sequences

Sometimes Cutadapt’s report ends with these lines:

WARNING:
    One or more of your adapter sequences may be incomplete.
    Please see the detailed output above.

Further up, you’ll see a message like this:

Bases preceding removed adapters:
  A: 95.5%
  C: 1.0%
  G: 1.6%
  T: 1.6%
  none/other: 0.3%
WARNING:
    The adapter is preceded by "A" extremely often.
    The provided adapter sequence may be incomplete.
    To fix the problem, add "A" to the beginning of the adapter sequence.

This means that in 95.5% of the cases in which an adapter was removed from a read, the base coming before that was an A. If your DNA fragments are not random, such as in amplicon sequencing, then this is to be expected and the warning can be ignored. If the DNA fragments are supposed to be random, then the message may be genuine: The adapter sequence may be incomplete and should include an additional A in the beginning.

This warning exists because some documents list the Illumina TruSeq adapters as starting with GATCGGA.... While that is technically correct, the library preparation actually results in an additional A before that sequence, which also needs to be removed. See the previous section for the correct sequence.

Dealing with N bases

Cutadapt supports the following options to deal with N bases in your reads:

--max-n COUNT
Discard reads containing more than COUNT N bases. A fractional COUNT between 0 and 1 can also be given and will be treated as the proportion of maximally allowed N bases in the read.
--trim-n

Remove flanking N bases from each read. That is, a read such as this:

NNACGTACGTNNNN

Is trimmed to just ACGTACGT. This option is applied after adapter trimming. If you want to get rid of N bases before adapter removal, use quality trimming: N bases typically also have a low quality value associated with them.

Cutadapt’s output

Reporting

Cutadapt will by default print a full report after it has finished processing the reads. To suppress all output except error messages, use the option --quiet.

The report type can be changed to a one-line summary with the option --report=minimal. The output will be a tab-separated table (tsv) with one header row and one row of content. Here is an example:

$ cutadapt --report=minimal -a ... -m 20 -q 10 -o ... -p ... in.[12].fastq.gz
status in_reads in_bp     too_short too_long too_many_n out_reads w/adapters qualtrim_bp out_bp w/adapters2 qualtrim2_bp out2_bp
OK     1000000  202000000 24827     0        0          975173    28968      1674222     97441426 0 0 98492473

This is the meaning of each column:

Column heading Explanation
status Incomplete adapter warning (OK or WARN)
in_reads Number of processed reads (read pairs for paired-end)
in_bp Number of processed basepairs
too_short Number of reads/read pairs that were too short
too_long Number of reads/read pairs that were too long
too_many_n Number of reads/read pairs that contained too many N
out_reads Number of reads written
w/adapters Number of reads containing at least one adapter
qualtrim_bp Number of bases removed from R1 reads by quality trimming
out_bp Number of bases written to R1 reads
w/adapters2 Number of R2 reads containing at least one adapter
qualtrim2_bp Number of bases removed from R3 reads by quality trimming
out2_bp Number of bases written

The last three fields are omitted for single-end data.

How to read the report

After every run, Cutadapt prints out per-adapter statistics. The output starts with something like this:

Sequence: 'ACGTACGTACGTTAGCTAGC'; Length: 20; Trimmed: 2402 times.

The meaning of this should be obvious. If option --revcomp was used, this line will additionally contain something like Reverse-complemented: 984 times. This describes how many times of the 2402 total times the adapter was found on the reverse complement of the read.

The next piece of information is this:

No. of allowed errors:
0-7 bp: 0; 8-15 bp: 1; 16-20 bp: 2

The adapter, as was shown above, has a length of 20 characters. We are using a custom error rate of 0.12. What this implies is shown above: Matches up to a length of 7 bp are allowed to have no errors. Matches of lengths 8-15 bp are allowd to have 1 error and matches of length 16 or more can have 2 errors. See also the section about error-tolerant matching.

Finally, a table is output that gives more detailed information about the lengths of the removed sequences. The following is only an excerpt; some rows are left out:

Overview of removed sequences
length  count   expect  max.err error counts
3       140     156.2   0       140
4       57      39.1    0       57
5       50      9.8     0       50
6       35      2.4     0       35
7       13      0.3     0       1 12
8       31      0.1     1       0 31
...
100     397     0.0     3       358 36 3

The first row tells us the following: Three bases were removed in 140 reads; randomly, one would expect this to occur 156.2 times; the maximum number of errors at that match length is 0 (this is actually redundant since we know already that no errors are allowed at lengths 0-7 bp).

The last column shows the number of reads that had 0, 1, 2 … errors. In the last row, for example, 358 reads matched the adapter with zero errors, 36 with 1 error, and 3 matched with 2 errors.

In the row for length 7 is an apparent anomaly, where the max.err column is 0 and yet we have 31 reads matching with 1 error. This is because the matches are actually contributed by alignments to the first 8 bases of the adapter with one deletion, so 7 bases are removed but the error cut-off applied is for length 8.

The “expect” column gives only a rough estimate of the number of sequences that is expected to match randomly, but it can help to estimate whether the matches that were found are true adapter matches or if they are due to chance. At lengths 6, for example, only 2.4 reads are expected, but 35 do match, which hints that most of these matches are due to actual adapters. For slightly more accurate estimates, you can provide the correct GC content (as a percentage) of your reads with the option --gc-content. The default is --gc-content=50.

Note that the “length” column refers to the length of the removed sequence. That is, the actual length of the match in the above row at length 100 is 20 since that is the adapter length. Assuming the read length is 100, the adapter was found in the beginning of 397 reads and therefore those reads were trimmed to a length of zero.

The table may also be useful in case the given adapter sequence contains an error. In that case, it may look like this:

...
length  count   expect  max.err error counts
10      53      0.0     1       51 2
11      45      0.0     1       42 3
12      51      0.0     1       48 3
13      39      0.0     1       0 39
14      40      0.0     1       0 40
15      36      0.0     1       0 36
...

We can see that no matches longer than 12 have zero errors. In this case, it indicates that the 13th base of the given adapter sequence is incorrect.

Format of the info file

When the --info-file command-line parameter is given, detailed information about where adapters were found in each read are written to the given file. It is a tab-separated text file that contains at least one row per input read. Normally, there is exactly one row per input read, but in the following cases, multiple rows may be output:

  • The option --times is in use.
  • A linked adapter is used.

A row is written for all input reads, even those that are discarded from the final FASTA/FASTQ output due to filtering options (such as --minimum-length). Which fields are output in each row depends on whether an adapter match was found in the read or not.

The fields in a row that describes a match are:

  1. Read name
  2. Number of errors
  3. 0-based start coordinate of the adapter match
  4. 0-based end coordinate of the adapter match
  5. Sequence of the read to the left of the adapter match (can be empty)
  6. Sequence of the read that was matched to the adapter
  7. Sequence of the read to the right of the adapter match (can be empty)
  8. Name of the found adapter.
  9. Quality values corresponding to sequence left of the adapter match (can be empty)
  10. Quality values corresponding to sequence matched to the adapter (can be empty)
  11. Quality values corresponding to sequence to the right of the adapter match (can be empty)

The concatenation of the fields 5-7 yields the full read sequence. Column 8 identifies the found adapter. The section about named adapters <named-adapters> describes how to give a name to an adapter. Adapters without a name are numbered starting from 1. Fields 9-11 are empty if quality values are not available. Concatenating them yields the full sequence of quality values.

If no adapter was found, the format is as follows:

  1. Read name
  2. The value -1 (use this to distinguish between match and non-match)
  3. The read sequence
  4. Quality values

When parsing the file, be aware that additional columns may be added in the future. Also, some fields can be empty, resulting in consecutive tabs within a line.

If the --times option is used and greater than 1, each read can appear more than once in the info file. There will be one line for each found adapter, all with identical read names. Only for the first of those lines will the concatenation of columns 5-7 be identical to the original read sequence (and accordingly for columns 9-11). For subsequent lines, the shown sequence are the ones that were used in subsequent rounds of adapter trimming, that is, they get successively shorter.

Linked adapters appear with up to two rows for each read, one for each constituent adapter for which a match has been found. To be able to see which of the two adapters a row describes, the adapter name in column 8 is modified: If the row describes a match of the 5’ adapter, the string ;1 is added. If it describes a match of the 3’ adapter, the string ;2 is added. If there are two rows, the 5’ match always comes first.

New in version 1.9: Columns 9-11 were added.

New in version 2.8: Linked adapters in info files work.

Colorspace

Support for processing data in so-called “colorspace”, as produced by the ABI SOLiD sequencer, was removed from Cutadapt versions newer than 1.18.

To process colorspace data, please use Cutadapt 1.18 or earlier. That version also knows how to process .csfasta/.qual file pairs.

See also the colorspace section in the documentation for Cutadapt 1.18.

Algorithm details

Adapter alignment algorithm

Since the publication of the EMBnet journal application note about Cutadapt, the alignment algorithm used for finding adapters has changed significantly. An overview of this new algorithm is given in this section. An even more detailed description is available in Chapter 2 of my PhD thesis Algorithms and tools for the analysis of high-throughput DNA sequencing data.

The algorithm is based on semiglobal alignment, also called free-shift, ends-free or overlap alignment. In a regular (global) alignment, the two sequences are compared from end to end and all differences occuring over that length are counted. In semiglobal alignment, the sequences are allowed to freely shift relative to each other and differences are only penalized in the overlapping region between them:

   FANTASTIC
ELEFANT

The prefix ELE and the suffix ASTIC do not have a counterpart in the respective other row, but this is not counted as an error. The overlap FANT has a length of four characters.

Traditionally, alignment scores are used to find an optimal overlap aligment: This means that the scoring function assigns a positive value to matches, while mismatches, insertions and deletions get negative values. The optimal alignment is then the one that has the maximal total score. Usage of scores has the disadvantage that they are not at all intuitive: What does a total score of x mean? Is that good or bad? How should a threshold be chosen in order to avoid finding alignments with too many errors?

For Cutadapt, the adapter alignment algorithm uses unit costs instead. This means that mismatches, insertions and deletions are counted as one error, which is easier to understand and allows to specify a single parameter for the algorithm (the maximum error rate) in order to describe how many errors are acceptable.

There is a problem with this: When using costs instead of scores, we would like to minimize the total costs in order to find an optimal alignment. But then the best alignment would always be the one in which the two sequences do not overlap at all! This would be correct, but meaningless for the purpose of finding an adapter sequence.

The optimization criteria are therefore a bit different. The basic idea is to consider the alignment optimal that maximizes the overlap between the two sequences, as long as the allowed error rate is not exceeded.

Conceptually, the procedure is as follows:

  1. Consider all possible overlaps between the two sequences and compute an alignment for each, minimizing the total number of errors in each one.
  2. Keep only those alignments that do not exceed the specified maximum error rate.
  3. Then, keep only those alignments that have a maximal number of matches (that is, there is no alignment with more matches).
  4. If there are multiple alignments with the same number of matches, then keep only those that have the smallest error rate.
  5. If there are still multiple candidates left, choose the alignment that starts at the leftmost position within the read.

In Step 1, the different adapter types are taken into account: Only those overlaps that are actually allowed by the adapter type are actually considered.

Quality trimming algorithm

The trimming algorithm implemented in Cutadapt is the same as the one used by BWA, but applied to both ends of the read in turn (if requested). That is: Subtract the given cutoff from all qualities; compute partial sums from all indices to the end of the sequence; cut the sequence at the index at which the sum is minimal. If both ends are to be trimmed, repeat this for the other end.

The basic idea is to remove all bases starting from the end of the read whose quality is smaller than the given threshold. This is refined a bit by allowing some good-quality bases among the bad-quality ones. In the following example, we assume that the 3’ end is to be quality-trimmed.

Assume you use a threshold of 10 and have these quality values:

42, 40, 26, 27, 8, 7, 11, 4, 2, 3

Subtracting the threshold gives:

32, 30, 16, 17, -2, -3, 1, -6, -8, -7

Then sum up the numbers, starting from the end (partial sums). Stop early if the sum is greater than zero:

(70), (38), 8, -8, -25, -23, -20, -21, -15, -7

The numbers in parentheses are not computed (because 8 is greater than zero), but shown here for completeness. The position of the minimum (-25) is used as the trimming position. Therefore, the read is trimmed to the first four bases, which have quality values 42, 40, 26, 27.

Recipes and FAQ

This section gives answers to frequently asked questions. It shows you how to get Cutadapt to do what you want it to do!

Remove more than one adapter

If you want to remove a 5’ and 3’ adapter at the same time, use the support for linked adapters.

If your situation is different, for example, when you have many 5’ adapters but only one 3’ adapter, then you have two options.

First, you can specify the adapters and also --times=2 (or the short version -n 2). For example:

cutadapt -g ^TTAAGGCC -g ^AAGCTTA -a TACGGACT -n 2 -o output.fastq input.fastq

This instructs Cutadapt to run two rounds of adapter finding and removal. That means that, after the first round and only when an adapter was actually found, another round is performed. In both rounds, all given adapters are searched and removed. The problem is that it could happen that one adapter is found twice (so the 3’ adapter, for example, could be removed twice).

The second option is to not use the -n option, but to run Cutadapt twice, first removing one adapter and then the other. It is easiest if you use a pipe as in this example:

cutadapt -g ^TTAAGGCC -g ^AAGCTTA input.fastq | cutadapt -a TACGGACT - > output.fastq

Trim poly-A tails

If you want to trim a poly-A tail from the 3’ end of your reads, use the 3’ adapter type (-a) with an adapter sequence of many repeated A nucleotides. Starting with version 1.8 of Cutadapt, you can use the following notation to specify a sequence that consists of 100 A:

cutadapt -a "A{100}" -o output.fastq input.fastq

This also works when there are sequencing errors in the poly-A tail. So this read

TACGTACGTACGTACGAAATAAAAAAAAAAA

will be trimmed to:

TACGTACGTACGTACG

If for some reason you would like to use a shorter sequence of A, you can do so: The matching algorithm always picks the leftmost match that it can find, so Cutadapt will do the right thing even when the tail has more A than you used in the adapter sequence. However, sequencing errors may result in shorter matches than desired. For example, using -a "A{10}", the read above (where the AAAT is followed by eleven A) would be trimmed to:

TACGTACGTACGTACGAAAT

Depending on your application, perhaps a variant of -a A{10}N{90} is an alternative, forcing the match to be located as much to the left as possible, while still allowing for non-A bases towards the end of the read.

Trim a fixed number of bases after adapter trimming

If the adapters you want to remove are preceded by some unknown sequence (such as a random tag/molecular identifier), you can specify this as part of the adapter sequence in order to remove both in one go.

For example, assume you want to trim Illumina adapters preceded by 10 bases that you want to trim as well. Instead of this command:

cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...

Use this command:

cutadapt -O 13 -a N{10}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...

The -O 13 is the minimum overlap for an adapter match, where the 13 is computed as 3 plus 10 (where 3 is the default minimum overlap and 10 is the length of the unknown section). If you do not specify it, the adapter sequence would match the end of every read (because N matches anything), and ten bases would then be removed from every read.

Trimming (amplicon-) primers from both ends of paired-end reads

If you want to remove primer sequences that flank your sequence of interest, you should use a “linked adapter” to remove them. If you have paired-end data (with R1 and R2), you can correctly trim both R1 and R2 by using linked adapters for both R1 and R2. Here is how to do this.

The full DNA fragment that is put on the sequencer looks like this (looking only at the forward strand):

5’ sequencing primer – forward primer – sequence of interest – reverse complement of reverse primer – reverse complement of 3’ sequencing primer

Since sequencing of R1 starts after the 5’ sequencing primer, R1 will start with the forward primer and then continue into the sequence of interest and into the two primers to the right of it, depending on the read length and how long the sequence of interest is. For R1, the linked adapter option that needs to be used is therefore

-a FWDPRIMER...RCREVPRIMER

where FWDPRIMER needs to be replaced with the sequence of your forward primer and RCREVPRIMER with the reverse complement of the reverse primer. The three dots ... need to be entered as they are – they tell Cutadapt that this is a linked adapter with a 5’ and a 3’ part.

Sequencing of R2 starts before the 3’ sequencing primer and proceeds along the reverse-complementary strand. For the correct linked adapter, the sequences from above therefore need to be swapped and reverse-complemented:

-A REVPRIMER...RCFWDPRIMER

The uppercase -A specifies that this option is meant to work on R2. Similar to above, REVPRIMER is the sequence of the reverse primer and RCFWDPRIMER is the reverse-complement of the forward primer. Note that Cutadapt does not reverse-complement any sequences of its own; you will have to do that yourself.

Finally, you may want to filter the trimmed read pairs. Use --discard-untrimmed to throw away all read pairs in which R1 doesn’t start with FWDPRIMER or in which R2 does not start with REVPRIMER.

A note on how the filtering works: In linked adapters, by default the first part (before the ...) is anchored. Anchored sequences must occur. If they don’t, then the other sequence (after the ...) is not even searched for and the entire read is internally marked as “untrimmed”. This is done for both R1 and R2 and as soon as any of them is marked as “untrimmed”, the entire pair is considered to be “untrimmed”. If --discard-untrimmed is used, this means that the entire pair is discarded if R1 or R2 are untrimmed. (Option --pair-filter=both can be used to change this to require that both were marked as untrimmed.)

In summary, this is how to trim your data and discard all read pairs that do not contain the primer sequences that you know must be there:

cutadapt -a FWDPRIMER...RCREVPRIMER -A REVPRIMER...RCFWDPRIMER --discard-untrimmed -o out.1.fastq.gz -p out.2.fastq.gz in.1.fastq.gz in.2.fastq.gz

Piping paired-end data

Sometimes it is necessary to run Cutadapt twice on your data. For example, when you want to change the order in which read modification or filtering options are applied. To simplify this, you can use Unix pipes (|), but this is more difficult with paired-end data since then input and output consists of two files each.

The solution is to interleave the paired-end data, send it over the pipe and then de-interleave it in the other process. Here is how this looks in principle:

cutadapt [options] --interleaved in.1.fastq.gz in.2.fastq.gz | \
  cutadapt [options] --interleaved -o out.1.fastq.gz -p out.2.fastq.gz -

Note the - character in the second invocation to Cutadapt.

Support for concatenated compressed files

Cutadapt supports concatenated gzip and bzip2 input files.

Paired-end read name check

When reading paired-end files, Cutadapt checks whether the read names match. Only the part of the read name before the first space is considered. If the read name ends with 1 or 2, then that is also ignored. For example, two FASTQ headers that would be considered to denote properly paired reads are:

@my_read/1 a comment

and:

@my_read/2 another comment

This is an example for improperly paired read names:

@my_read/1;1

and:

@my_read/2;1

Since the 1 and 2 are ignored only if the occur at the end of the read name, and since the ;1 is considered to be part of the read name, these reads will not be considered to be propely paired.

Rescuing single reads from paired-end reads that were filtered

When trimming and filtering paired-end reads, Cutadapt always discards entire read pairs. If you want to keep one of the reads, you need to write the filtered read pairs to an output file and postprocess it.

For example, assume you are using -m 30 to discard too short reads. Cutadapt discards all read pairs in which just one of the reads is too short (but see the --pair-filter option). To recover those (individual) reads that are long enough, you can first use the --too-short-(paired)-output options to write the filtered pairs to a file, and then postprocess those files to keep only the long enough reads.

cutadapt -m 30 -q 20 -o out.1.fastq.gz -p out.2.fastq.gz –too-short-output=tooshort.1.fastq.gz –too-short-paired-output=tooshort.2.fastq.gz in.1.fastq.gz in.2.fastq.gz cutadapt -m 30 -o rescued.a.fastq.gz tooshort.1.fastq.gz cutadapt -m 30 -o rescued.b.fastq.gz tooshort.2.fastq.gz

The two output files rescued.a.fastq.gz and rescued.b.fastq.gz contain those individual reads that are long enough. Note that the file names do not end in .1.fastq.gz and .2.fastq.gz to make it very clear that these files no longer contain synchronized paired-end reads.

Bisulfite sequencing (RRBS)

When trimming reads that come from a library prepared with the RRBS (reduced representation bisulfite sequencing) protocol, the last two 3’ bases must be removed in addition to the adapter itself. This can be achieved by using not the adapter sequence itself, but by adding two wildcard characters to its beginning. If the adapter sequence is ADAPTER, the command for trimming should be:

cutadapt -a NNADAPTER -o output.fastq input.fastq

Details can be found in Babraham bioinformatics’ “Brief guide to RRBS”. A summary follows.

During RRBS library preparation, DNA is digested with the restriction enzyme MspI, generating a two-base overhang on the 5’ end (CG). MspI recognizes the sequence CCGG and cuts between C and CGG. A double-stranded DNA fragment is cut in this way:

5'-NNNC|CGGNNN-3'
3'-NNNGGC|CNNN-5'

The fragment between two MspI restriction sites looks like this:

5'-CGGNNN...NNNC-3'
  3'-CNNN...NNNGGC-5'

Before sequencing (or PCR) adapters can be ligated, the missing base positions must be filled in with GTP and CTP:

5'-ADAPTER-CGGNNN...NNNCcg-ADAPTER-3'
3'-ADAPTER-gcCNNN...NNNGGC-ADAPTER-5'

The filled-in bases, marked in lowercase above, do not contain any original methylation information, and must therefore not be used for methylation calling. By prefixing the adapter sequence with NN, the bases will be automatically stripped during adapter trimming.

File format conversion

You can use Cutadapt to convert FASTQ to FASTA format:

cutadapt -o output.fasta.gz input.fastq.gz

Cutadapt detects that the file name extension of the output file is .fasta and writes in FASTA format, omitting the qualities.

When writing to standard output, you need to use the --fasta option:

cutadapt --fasta input.fastq.gz > out.fasta

Without the option, Cutadapt writes in FASTQ format.

Other things (unfinished)

  • How to detect adapters
  • Use Cutadapt for quality-trimming only
  • Use it for minimum/maximum length filtering

Ideas/To Do

This is a rather unsorted list of features that would be nice to have, of things that could be improved in the source code, and of possible algorithmic improvements.

  • show average error rate
  • run pylint, pychecker
  • length histogram
  • --detect prints out best guess which of the given adapters is the correct one
  • allow to remove not the adapter itself, but the sequence before or after it
  • warn when given adapter sequence contains non-IUPAC characters
  • extensible file type detection

Backwards-incompatible changes

  • Drop --rest-file support
  • Possibly drop wildcard-file support, extend info-file instead
  • For non-anchored 5’ adapters, find rightmost match

Specifying adapters

The idea is to deprecate the -b, -g and -u parameters. Only -a is used with a special syntax for each adapter type. This makes it a bit easier to add new adapter types in the feature.

back -a ADAPTER -a ADAPTER or -a ...ADAPTER
suffix -a ADAPTER$ -a ...ADAPTER$
front -g ADAPTER -a ADAPTER...
prefix -g ^ADAPTER -a ^ADAPTER... (or have anchoring by default?)
anywhere -b ADAPTER -a ...ADAPTER... ???
unconditional -u +10 -a 10... (collides with colorspace)
unconditional -u -10 -a ...10$
linked -a ADAPTER...ADAPTER -a ADAPTER...ADAPTER or -a ^ADAPTER...ADAPTER

Or add only -a ADAPTER... as an alias for -g ^ADAPTER and -a ...ADAPTER as an alias for -a ADAPTER.

The ... would be equivalent to N* as in regular expressions.

Another idea: Allow something such as -a ADAP$TER or -a ADAPTER$NNN. This would be a way to specify less strict anchoring.

Make it possible to specify that the rightmost or leftmost match should be picked. Default right now: Leftmost, even for -g adapters.

Allow N{3,10} as in regular expressions (for a variable-length sequence).

Use parentheses to specify the part of the sequence that should be kept:

  • -a (...)ADAPTER (default)
  • -a (...ADAPTER) (default)
  • -a ADAPTER(...) (default)
  • -a (ADAPTER...) (??)

Or, specify the part that should be removed:

-a ...(ADAPTER...) -a ...ADAPTER(...) -a (ADAPTER)...

Model somehow all the flags that exist for semiglobal alignment. For start of the adapter:

  • Start of adapter can be degraded or not
  • Bases are allowed to be before adapter or not

Not degraded and no bases before allowed = anchored. Degraded and bases before allowed = regular 5’

Paired-end trimming

  • Could also use a paired-end read merger, then remove adapters with -a and -g

Available letters for command-line options

  • Lowercase letters: i, k, s, w
  • Uppercase letters: C, D, E, F, H, I, J, K, L, P, R, S, T, V, W
  • Deprecated, could be re-used: c, d, t
  • Planned/reserved: Q (paired-end quality trimming), V (alias for –version)

Developing

The Cutadapt source code is on GitHub. Cutadapt is written in Python 3 with some extension modules that are written in Cython. Support for Python 2 has been dropped.

Development installation

For development, make sure that you install Cython and tox. We also recommend using a virtualenv. This sequence of commands should work:

git clone https://github.com/marcelm/cutadapt.git  # or clone your own fork
cd cutadapt
python3 -m venv venv
venv/bin/pip3 install Cython pytest nose tox
venv/bin/pip3 install -e .

Then you can run Cutadapt like this (or activate the virtualenv and omit the venv/bin part):

venv/bin/cutadapt --help

The tests can then be run like this:

venv/bin/pytest

Or with tox (but then you will need to have binaries for all tested Python versions installed):

venv/bin/tox

Making a release

Since version 1.17, Travis CI is used to automatically deploy a new Cutadapt release (both as an sdist and as wheels) whenever a new tag is pushed to the Git repository.

Cutadapt uses setuptools_scm to automatically manage version numbers. This means that the version is not stored in the source code but derived from the most recent Git tag. The following procedure can be used to bump the version and make a new release.

  1. Update CHANGES.rst (version number and list of changes)

  2. Ensure you have no uncommitted changes in the working copy.

  3. Run a git pull.

  4. Run tox, ensuring all tests pass.

  5. Tag the current commit with the version number (there must be a v prefix):

    git tag v0.1
    

    To release a development version, use a dev version number such as v1.17.dev1. Users will not automatically get these unless they use pip install --pre.

  6. Push the tag:

    git push --tags
    
  7. Wait for Travis to finish and to deploy to PyPI.

  8. The bioconda recipe also needs to be updated, but the bioconda bot will likely do this automatically if you just wait a little while.

    Ensure that the list of dependencies (the requirements: section in the recipe) is in sync with the setup.py file.

If something went wrong after a version has already been tagged and published to PyPI, fix the problem and tag a new version. Do not change a version that has already been uploaded.

Contributing

Contributions to Cutadapt in the form of source code or documentation improvements or helping out with responding to issues are welcome!

To contribute to Cutadapt development, it is easiest to send in a pull request (PR) on GitHub.

Here are some guidelines for how to do this. They are not strict rules. When in doubt, send in a PR and we will sort it out.

  • Limit a PR to a single topic. Submit multiple PRs if necessary. This way, it is easier to discuss the changes individually, and in case we find that one of them should not go in, the others can still be accepted.
  • For larger changes, consider opening an issue first to plan what you want to do.
  • Include appropriate unit or integration tests. Sometimes, tests are hard to write or don’t make sense. If you think this is the case, just leave the tests out initially and we can discuss whether to add any.
  • Add documentation and a changelog entry if appropriate.

Code style

  • Cutadapt tries to follow PEP8, except that the allowed line length is 100 characters, not 80. But try to wrap comments after 80 characters.
  • There are inconsistencies in the current code base since it’s a few years old already. New code should follow the current rules, however.
  • At the moment, no automatic code formatting is done, but one idea might be to switch to the black code formatter at some point. If you’re familiar with its style, you can use that already now for new code to make the diff smaller.
  • Prefer double quotation marks in new code. This will also make the diff smaller if we eventually switch to black.
  • Using an IDE is beneficial (PyCharm, for example). It helps to catch lots of style issues early (unused imports, spacing etc.).
  • Avoid unnecessary abbreviations for variable names. Code is more often read than written.
  • When writing a help text for a new command-line option, look at the output of cutadapt --help and try to make it look nice and short.
  • In comments and documentation, capitalize FASTQ, BWA, CPU etc.

Changes

v3.1 (2020-12-03)

  • #443: With --action=retain, it is now possible to trim reads while leaving the adapter sequence itself in the read. That is, only the sequence before (for 5’ adapters) or after (for 3’ adapters) is removed. With linked adapters, both adapters are retained.
  • #495: Running with multiple cores did not work using macOS and Python 3.8+. To prevent problems like these in the future, automated testing has been extended to also run on macOS.
  • #482: Print statistics for --discard-casava and --max-ee in the report.
  • #497: The changelog for 3.0 previously forgot to mention that the following options, which were deprecated in version 2.0, have now been removed, and using them will lead to an error: --format, --colorspace, -c, -d, --double-encode, -t, --trim-primer, --strip-f3, --maq, --bwa, --no-zero-cap. This frees up some single-character options, allowing them to be re-purposed for future Cutadapt features.

v3.0 (2020-11-10)

  • Demultiplexing on multiple cores is now supported. This was the last feature that only ran single-threaded.
  • #478: Demultiplexing now always generates all possible output files.
  • #358: You can now use -e also to specify the maximum number of errors (instead of the maximum error rate). For example, write -e 2 to allow two errors over a full-length adapter match.
  • #486: Trimming many anchored adapters (for example when demultiplexing) is now faster by using an index even when indels are allowed. Previously, Cutadapt would only be able to build an index with --no-indels.
  • #469: Cutadapt did not run under Python 3.8 on recent macOS versions.
  • #425: Change the default compression level for .gz output files from 6 to 5. This reduces the time used for compression by about 50% while increasing file size by less than 10%. To get the old behavior, use --compression-level=6. If you use Cutadapt to create intermediate files that are deleted anyway, consider also using the even faster option -Z (same as --compression-level=1).
  • #485: Fix that, under some circumstances, in particular when trimming a 5’ adapter and there was a mismatch in its last nucleotide(s), not the entire adapter sequence would be trimmed from the read. Since fixing this required changed the alignment algorithm slightly, this is a backwards incompatible change.
  • Fix that the report did not include the number of reads that are too long, too short or had too many N. (This unintentionally disappeared in a previous version.)
  • #487: When demultiplexing, the reported number of written pairs was always zero.
  • #497: The following options, which were deprecated in version 2.0, have been removed, and using them will lead to an error: --format, --colorspace, -c, -d, --double-encode, -t, --trim-primer, --strip-f3, --maq, --bwa, --no-zero-cap. This frees up some single-character options, allowing them to be re-purposed for future Cutadapt features.
  • Ensure Cutadapt runs under Python 3.9.
  • Drop support for Python 3.5.

v2.10 (2020-04-22)

  • Fixed a performance regression introduced in version 2.9.
  • #449: --action= could not be used with --pair-adapters. Fix contributed by wlokhorst.
  • #450: --untrimmed-output, --too-short-output and --too-long-output can now be written interleaved.
  • #453: Fix problem that N wildcards in adapters did not match N characters in the read. N characters now match any character in the read, independent of whether --match-read-wildcards is used or not.
  • With --action=lowercase/mask, print which sequences would have been removed in the “Overview of removed sequences” statistics. Previously, it would show that no sequences have been removed.

v2.9 (2020-03-18)

  • #441: Add a --max-ee (or --max-expected-errors) option for filtering reads whose number of expected errors exceeds the given threshold. The idea comes from Edgar et al. (2015).
  • #438: The info file now contains the `` rc`` suffix that is added to the names of reverse-complemented reads (with --revcomp).
  • #448: .bz2 and .xz output wasn’t possible in multi-core mode.

v2.8 (2020-01-13)

  • #220: With option --revcomp, Cutadapt now searches both the read and its reverse complement for adapters. The version that matches best is kept. This can be used to “normalize” strandedness.
  • #430: --action=lowercase now works with linked adapters
  • #431: Info files can now be written even for linked adapters.

v2.7 (2019-11-22)

  • #427: Multicore is now supported even when using --info-file, --rest-file or --wildcard-file. The only remaining feature that still does not work with multicore is now demultiplexing.
  • #290: When running on a single core, Cutadapt no longer spawns external pigz processes for writing gzip-compressed files. This is a first step towards ensuring that using --cores=n uses only at most n CPU cores.
  • This release adds support for Python 3.8.

v2.6 (2019-10-26)

  • #395: Do not show animated progress when --quiet is used.
  • #399: When two adapters align to a read equally well (in terms of the number of matches), prefer the alignment that has fewer errors.
  • #401 Give priority to adapters given earlier on the command line. Previously, the priority was: All 3’ adapters, all 5’ adapters, all anywhere adapters. In rare cases this could lead to different results.
  • #404: Fix an issue preventing Cutadapt from being used on Windows.
  • This release no longer supports Python 3.4 (which has reached end of life).

v2.5 (2019-09-04)

  • #391: Multicore is now supported even when using --untrimmed-output, --too-short-output, --too-long-output or the corresponding ...-paired-output options.
  • #393: Using --info-file no longer crashes when processing paired-end data. However, the info file itself will only contain results for R1.
  • #394: Options -e/--no-indels/-O were ignored for linked adapters
  • #320: When a “Too many open files” error occurs during demultiplexing, Cutadapt can now automatically raise the limit and re-try if the limit is a “soft” limit.

v2.4 (2019-07-09)

  • #292: Implement support for demultiplexing paired-end reads that use combinatorial indexing (“combinatorial demultiplexing”).
  • #384: Speed up reading compressed files by requiring an xopen version that uses an external pigz process even for reading compressed input files (not only for writing).
  • #381: Fix --report=minimal not working.
  • #380: Add a --fasta option for forcing that FASTA is written to standard output even when input is FASTQ. Previously, forcing FASTA was only possible by providing an output file name.

v2.3 (2019-04-25)

  • #378: The --pair-adapters option, added in version 2.1, was not actually usable for demultiplexing.

v2.2 (2019-04-20)

  • #376: Fix a crash when using anchored 5’ adapters together with --no-indels and trying to trim an empty read.
  • #369: Fix a crash when attempting to trim an empty read using a -g adapter with wildcards.

v2.1 (2019-03-15)

  • #366: Fix problems when combining --cores with reading from standard input or writing to standard output.
  • #347: Support “paired adapters”. One use case is demultiplexing Illumina Unique Dual Indices (UDI).

v2.0 (2019-03-06)

This is a major new release with lots of bug fixes and new features, but also some backwards-incompatible changes. These should hopefully not affect too many users, but please make sure to review them and possibly update your scripts!

Backwards-incompatible changes

  • #329: Linked adapters specified with -a ADAPTER1...ADAPTER2 are no longer anchored by default. To get results consist with the old behavior, use -a ^ADAPTER1...ADAPTER2 instead.
  • Support for colorspace data was removed. Thus, the following command-line options can no longer be used: -c, -d, -t, --strip-f3, --maq, --bwa, --no-zero-cap.
  • “Legacy mode” has been removed. This mode was enabled under certain conditions and would change the behavior such that the read-modifying options such as -q would only apply to the forward/R1 reads. This was necessary for compatibility with old Cutadapt versions, but became increasingly confusing.
  • #360: Computation of the error rate of an adapter match no longer counts the N wildcard bases. Previously, an adapter like N{18}CC (18 N wildcards followed by CC) would effectively match anywhere because the default error rate of 0.1 (10%) would allow for two errors. The error rate of a match is now computed as the number of non-N bases in the matching part of the adapter divided by the number of errors.
  • This release of Cutadapt requires at least Python 3.4 to run. Python 2.7 is no longer supported.

Features

  • A progress indicator is printed while Cutadapt is working. If you redirect standard error to a file, the indicator is disabled.
  • Reading of FASTQ files has gotten faster due to a new parser. The FASTA and FASTQ reading/writing functions are now available as part of the dnaio library. This is a separate Python package that can be installed independently from Cutadapt. There is one regression at the moment: FASTQ files that use a second header (after the “+”) will have that header removed in the output.
  • Some other performance optimizations were made. Speedups of up to 15% are possible.
  • Demultiplexing has become a lot faster under certain conditions.
  • #335: For linked adapters, it is now possible to specify which of the two adapters should be required, overriding the default.
  • #166: By specifying --action=lowercase, it is now possible to not trim adapters, but to instead convert the section of the read that would have been trimmed to lowercase.

Bug fixes

  • Removal of legacy mode fixes also #345: --length would not enable legacy mode.
  • The switch to dnaio also fixed #275: Input files with non-standard names now no longer lead to a crash. Instead the format is now recognized from the file content.
  • Fix #354: Sequences given using file: can now be unnamed.
  • Fix #257 and #242: When only R1 or only R2 adapters are given, the --pair-filter setting is now forced to both for the --discard-untrimmed (and --untrimmed-(paired-)output) filters. Otherwise, with the default --pair-filter=any, all pairs would be considered untrimmed because one of the reads in the pair is always untrimmed.

Other

  • #359: The -f/--format option is now ignored and a warning will be printed if it is used. The input file format is always auto-detected.

v1.18 (2018-09-07)

Features

  • Close #327: Maximum and minimum lengths can now be specified separately for R1 and R2 with -m LENGTH1:LENGTH2. One of the lengths can be omitted, in which case only the length of the other read is checked (as in -m 17: or -m :17).
  • Close #322: Use -j 0 to auto-detect how many cores to run on. This should even work correctly on cluster systems when Cutadapt runs as a batch job to which fewer cores than exist on the machine have been assigned. Note that the number of threads used by pigz cannot be controlled at the moment, see #290.
  • Close #225: Allow setting the maximum error rate and minimum overlap length per adapter. A new syntax for adapter-specific parameters was added for this. Example: -a "ADAPTER;min_overlap=5".
  • Close #152: Using the new syntax for adapter-specific parameters, it is now possible to allow partial matches of a 3’ adapter at the 5’ end (and partial matches of a 5’ adapter at the 3’ end) by specifying the anywhere parameter (as in -a "ADAPTER;anywhere").
  • Allow --pair-filter=first in addition to both and any. If used, a read pair is discarded if the filtering criterion applies to R1; and R2 is ignored.
  • Close #112: Implement a --report=minimal option for printing a succinct two-line report in tab-separated value (tsv) format. Thanks to @jvolkening for coming up with an initial patch!

Bug fixes

  • Fix #128: The “Reads written” figure in the report incorrectly included both trimmed and untrimmed reads if --untrimmed-output was used.

Other

  • The options --no-trim and --mask-adapter should now be written as --action=mask and --action=none. The old options still work.
  • This is the last release to support colorspace data.
  • This is the last release to support Python 2.

v1.17 (2018-08-20)

  • Close #53: Implement adapters that disallow internal matches. This is a bit like anchoring, but less strict: The adapter sequence can appear at different lengths, but must always be at one of the ends. Use -a ADAPTERX (with a literal X) to disallow internal matches for a 3’ adapter. Use -g XADAPTER to disallow for a 5’ adapter.
  • @klugem contributed PR #299: The --length option (and its alias -l) can now be used with negative lengths, which will remove bases from the beginning of the read instead of from the end.
  • Close #107: Add a --discard-casava option to remove reads that did not pass CASAVA filtering (this is possibly relevant only for older datasets).
  • Fix #318: Cutadapt should now be installable with Python 3.7.
  • Running Cutadapt under Python 3.3 is no longer supported (Python 2.7 or 3.4+ are needed)
  • Planned change: One of the next Cutadapt versions will drop support for Python 2 entirely, requiring Python 3.

v1.16 (2018-02-21)

  • Fix #291: When processing paired-end reads with multiple cores, there could be errors about incomplete FASTQs although the files are intact.
  • Fix #280: Quality trimming statistics incorrectly show the same values for R1 and R2.

v1.15 (2017-11-23)

  • Cutadapt can now run on multiple CPU cores in parallel! To enable it, use the option -j N (or the long form --cores=N), where N is the number of cores to use. Multi-core support is only available on Python 3, and not yet with some command-line arguments. See the new section about multi-core in the documentation for details. When writing .gz files, make sure you have pigz installed to get the best speedup.
  • The plan is to make multi-core the default (automatically using as many cores as are available) in future releases, so please test it and report an issue if you find problems!
  • Issue #256: --discard-untrimmed did not have an effect on non-anchored linked adapters.
  • Issue #118: Added support for demultiplexing of paired-end data.

v1.14 (2017-06-16)

  • Fix: Statistics for 3’ part of a linked adapter were reported incorrectly
  • Fix issue #244: Quality trimming with --nextseq-trim would not apply to R2 when trimming paired-end reads.
  • --nextseq-trim now disables legacy mode.
  • Fix issue #246: installation failed on non-UTF8 locale

v1.13 (2017-03-16)

  • The 3’ adapter of linked adapters can now be anchored. Write -a ADAPTER1...ADAPTER2$ to enable this. Note that the 5’ adapter is always anchored in this notation.
  • Issue #224: If you want the 5’ part of a linked adapter not to be anchored, you can now write -g ADAPTER...ADAPTER2 (note -g instead of -a). This feature is experimental and may change behavior in the next release.
  • Issue #236: For more accurate statistics, it is now possible to specify the GC content of the input reads with --gc-content. This does not change trimming results, only the number in the “expect” column of the report. Since this is probably not needed by many people, the option is not listed when running cutadapt --help.
  • Issue #235: Adapter sequences are now required to contain only valid IUPAC codes (lowercase is also allowed, U is an alias for T). This should help to catch hard-to-find bugs, especially in scripts. Use option -N to match characters literally (possibly useful for amino acid sequences).
  • Documentation updates and some refactoring of the code

v1.12 (2016-11-28)

  • Add read modification option --length (short: --l), which will shorten each read to the given length.
  • Cutadapt will no longer complain that it has nothing to do when you do not give it any adapters. For example, you can use this to convert file formats: cutadapt -o output.fasta input.fastq.gz converts FASTQ to FASTA.
  • The xopen module for opening compressed files was moved to a separate package on PyPI.

v1.11 (2016-08-16)

  • The --interleaved option no longer requires that both input and output is interleaved. It is now possible to have two-file input and interleaved output, and to have interleaved input and two-file output.
  • Fix issue #202: First and second FASTQ header could get out of sync when options modifying the read name were used.

v1.10 (2016-05-19)

  • Added a new “linked adapter” type, which can be used to search for a 5’ and a 3’ adapter at the same time. Use -a ADAPTER1...ADAPTER2 to search for a linked adapter. ADAPTER1 is interpreted as an anchored 5’ adapter, which is searched for first. Only if ADAPTER1 is found will ADAPTER2 be searched for, which is a regular 3’ adapter.
  • Added experimental --nextseq-trim option for quality trimming of NextSeq data. This is necessary because that machine cannot distinguish between G and reaching the end of the fragment (it encodes G as ‘black’).
  • Even when trimming FASTQ files, output can now be FASTA (quality values are simply dropped). Use the -o/-p options with a file name that ends in .fasta or .fa to enable this.
  • Cutadapt does not bundle pre-compiled C extension modules (.so files) anymore. This affects only users that run cutadapt directly from an unpacked tarball. Install through pip or conda instead.
  • Fix issue #167: Option --quiet was not entirely quiet.
  • Fix issue #199: Be less strict when checking for properly-paired reads.
  • This is the last version of cutadapt to support Python 2.6. Future versions will require at least Python 2.7.

v1.9.1 (2015-12-02)

v1.9 (2015-10-29)

  • Indels in the alignment can now be disabled for all adapter types (use --no-indels).
  • Quality values are now printed in the info file (--info-file) when trimming FASTQ files. Fixes issue #144.
  • Options --prefix and --suffix, which modify read names, now accept the placeholder {name} and will replace it with the name of the found adapter. Fixes issue #104.
  • Interleaved FASTQ files: With the --interleaved switch, paired-end reads will be read from and written to interleaved FASTQ files. Fixes issue #113.
  • Anchored 5’ adapters can now be specified by writing -a SEQUENCE... (note the three dots).
  • Fix --discard-untrimmed and --discard-trimmed not working as expected in paired-end mode (issue #146).
  • The minimum overlap is now automatically reduced to the adapter length if it is too large. Fixes part of issue #153.
  • Thanks to Wolfgang Gerlach, there is now a Dockerfile.
  • The new --debug switch makes cutadapt print out the alignment matrix.

v1.8.3 (2015-07-29)

  • Fix issue #95: Untrimmed reads were not listed in the info file.
  • Fix issue #138: pip install cutadapt did not work with new setuptools versions.
  • Fix issue #137: Avoid a hang when writing to two or more gzip-compressed output files in Python 2.6.

v1.8.2 (2015-07-24)

v1.8.1 (2015-04-09)

  • Fix #110: Counts for ‘too short’ and ‘too long’ reads were swapped in statistics.
  • Fix #115: Make --trim-n work also on second read for paired-end data.

v1.8 (2015-03-14)

  • Support single-pass paired-end trimming with the new -A/-G/-B/-U parameters. These work just like their -a/-g/-b/-u counterparts, but they specify sequences that are removed from the second read in a pair.

    Also, if you start using one of those options, the read modification options such as -q (quality trimming) are applied to both reads. For backwards compatibility, read modifications are applied to the first read only if neither of -A/-G/-B/-U is used. See the documentation for details.

    This feature has not been extensively tested, so please give feedback if something does not work.

  • The report output has been re-worked in order to accomodate the new paired-end trimming mode. This also changes the way the report looks like in single-end mode. It is hopefully now more accessible.

  • Chris Mitchell contributed a patch adding two new options: --trim-n removes any N bases from the read ends, and the --max-n option can be used to filter out reads with too many N.

  • Support notation for repeated bases in the adapter sequence: Write A{10} instead of AAAAAAAAAA. Useful for poly-A trimming: Use -a A{100} to get the longest possible tail.

  • Quality trimming at the 5’ end of reads is now supported. Use -q 15,10 to trim the 5’ end with a cutoff of 15 and the 3’ end with a cutoff of 10.

  • Fix incorrectly reported statistics (> 100% trimmed bases) when --times set to a value greater than one.

  • Support .xz-compressed files (if running in Python 3.3 or later).

  • Started to use the GitHub issue tracker instead of Google Code. All old issues have been moved.

v1.7 (2014-11-25)

  • IUPAC characters are now supported. For example, use -a YACGT for an adapter that matches both CACGT and TACGT with zero errors. Disable with -N. By default, IUPAC characters in the read are not interpreted in order to avoid matches in reads that consist of many (low-quality) N bases. Use --match-read-wildcards to enable them also in the read.
  • Support for demultiplexing was added. This means that reads can be written to different files depending on which adapter was found. See the section in the documentation for how to use it. This is currently only supported for single-end reads.
  • Add support for anchored 3’ adapters. Append $ to the adapter sequence to force the adapter to appear in the end of the read (as a suffix). Closes issue #81.
  • Option --cut (-u) can now be specified twice, once for each end of the read. Thanks to Rasmus Borup Hansen for the patch!
  • Options --minimum-length/--maximum-length (-m/-M) can be used standalone. That is, cutadapt can be used to filter reads by length without trimming adapters.
  • Fix bug: Adapters read from a FASTA file can now be anchored.

v1.6 (2014-10-07)

  • Fix bug: Ensure --format=... can be used even with paired-end input.
  • Fix bug: Sometimes output files would be incomplete because they were not closed correctly.
  • Alignment algorithm is a tiny bit faster.
  • Extensive work on the documentation. It’s now available at https://cutadapt.readthedocs.org/ .
  • For 3’ adapters, statistics about the bases preceding the trimmed adapter are collected and printed. If one of the bases is overrepresented, a warning is shown since this points to an incomplete adapter sequence. This happens, for example, when a TruSeq adapter is used but the A overhang is not taken into account when running cutadapt.
  • Due to code cleanup, there is a change in behavior: If you use --discard-trimmed or --discard-untrimmed in combination with --too-short-output or --too-long-output, then cutadapt now writes also the discarded reads to the output files given by the --too-short or --too-long options. If anyone complains, I will consider reverting this.
  • Galaxy support files are now in a separate repository.

v1.5 (2014-08-05)

  • Adapter sequences can now be read from a FASTA file. For example, write -a file:adapters.fasta to read 3’ adapters from adapters.fasta. This works also for -b and -g.
  • Add the option --mask-adapter, which can be used to not remove adapters, but to instead mask them with N characters. Thanks to Vittorio Zamboni for contributing this feature!
  • U characters in the adapter sequence are automatically converted to T.
  • Do not run Cython at installation time unless the –cython option is provided.
  • Add the option -u/–cut, which can be used to unconditionally remove a number of bases from the beginning or end of each read.
  • Make --zero-cap the default for colorspace reads.
  • When the new option --quiet is used, no report is printed after all reads have been processed.
  • When processing paired-end reads, cutadapt now checks whether the reads are properly paired.
  • To properly handle paired-end reads, an option –untrimmed-paired-output was added.

v1.4 (2014-03-13)

  • This release of cutadapt reduces the overhead of reading and writing files. On my test data set, a typical run of cutadapt (with a single adapter) takes 40% less time due to the following two changes.
  • Reading and writing of FASTQ files is faster (thanks to Cython).
  • Reading and writing of gzipped files is faster (up to 2x) on systems where the gzip program is available.
  • The quality trimming function is four times faster (also due to Cython).
  • Fix the statistics output for 3’ colorspace adapters: The reported lengths were one too short. Thanks to Frank Wessely for reporting this.
  • Support the --no-indels option. This disallows insertions and deletions while aligning the adapter. Currently, the option is only available for anchored 5’ adapters. This fixes issue 69.
  • As a sideeffect of implementing the –no-indels option: For colorspace, the length of a read (for --minimum-length and --maximum-length) is now computed after primer base removal (when --trim-primer is specified).
  • Added one column to the info file that contains the name of the found adapter.
  • Add an explanation about colorspace ambiguity to the README

v1.3 (2013-11-08)

  • Preliminary paired-end support with the --paired-output option (contributed by James Casbon). See the README section on how to use it.
  • Improved statistics.
  • Fix incorrectly reported amount of quality-trimmed Mbp (issue 57, fix by Chris Penkett)
  • Add the --too-long-output option.
  • Add the --no-trim option, contributed by Dave Lawrence.
  • Port handwritten C alignment module to Cython.
  • Fix the --rest-file option (issue 56)
  • Slightly speed up alignment of 5’ adapters.
  • Support bzip2-compressed files.

v1.2 (2012-11-30)

  • At least 25% faster processing of .csfasta/.qual files due to faster parser.
  • Between 10% and 30% faster writing of gzip-compressed output files.
  • Support 5’ adapters in colorspace, even when no primer trimming is requested.
  • Add the --info-file option, which has a line for each found adapter.
  • Named adapters are possible. Usage: -a My_Adapter=ACCGTA assigns the name “My_adapter”.
  • Improve alignment algorithm for better poly-A trimming when there are sequencing errors. Previously, not the longest possible poly-A tail would be trimmed.
  • James Casbon contributed the --discard-untrimmed option.

v1.1 (2012-06-18)

  • Allow to “anchor” 5’ adapters (-g), forcing them to be a prefix of the read. To use this, add the special character ^ to the beginning of the adapter sequence.
  • Add the “-N” option, which allows ‘N’ characters within adapters to match literally.
  • Speedup of approx. 25% when reading from .gz files and using Python 2.7.
  • Allow to only trim qualities when no adapter is given on the command-line.
  • Add a patch by James Casbon: include read names (ids) in rest file
  • Use nosetest for testing. To run, install nose and run “nosetests”.
  • When using cutadapt without installing it, you now need to run bin/cutadapt due to a new directory layout.
  • Allow to give a colorspace adapter in basespace (gets automatically converted).
  • Allow to search for 5’ adapters (those specified with -g) in colorspace.
  • Speed up the alignment by a factor of at least 3 by using Ukkonen’s algorithm. The total runtime decreases by about 30% in the tested cases.
  • allow to deal with colorspace FASTQ files from the SRA that contain a fake additional quality in the beginning (use --format sra-fastq)

v1.0 (2011-11-04)

  • ASCII-encoded quality values were assumed to be encoded as ascii(quality+33). With the new parameter --quality-base, this can be changed to ascii(quality+64), as used in some versions of the Illumina pipeline. (Fixes issue 7.)
  • Allow to specify that adapters were ligated to the 5’ end of reads. This change is based on a patch contributed by James Casbon.
  • Due to cutadapt being published in EMBnet.journal, I found it appropriate to call this release version 1.0. Please see http://journal.embnet.org/index.php/embnetjournal/article/view/200 for the article and I would be glad if you cite it.
  • Add Galaxy support, contributed by Lance Parsons.
  • Patch by James Casbon: Allow N wildcards in read or adapter or both. Wildcard matching of ‘N’s in the adapter is always done. If ‘N’s within reads should also match without counting as error, this needs to be explicitly requested via --match-read-wildcards.

v0.9.5 (2011-07-20)

  • Fix issue 20: Make the report go to standard output when -o/--output is specified.

  • Recognize .fq as an extension for FASTQ files

  • many more unit tests

  • The alignment algorithm has changed. It will now find some adapters that previously were missed. Note that this will produce different output than older cutadapt versions!

    Before this change, finding an adapter would work as follows:

    • Find an alignment between adapter and read – longer alignments are better.
    • If the number of errors in the alignment (divided by length) is above the maximum error rate, report the adapter as not being found.

    Sometimes, the long alignment that is found had too many errors, but a shorter alignment would not. The adapter was then incorrectly seen as “not found”. The new alignment algorithm checks the error rate while aligning and only reports alignments that do not have too many errors.

v0.9.4 (2011-05-20)

  • now compatible with Python 3
  • Add the --zero-cap option, which changes negative quality values to zero. This is a workaround to avoid segmentation faults in BWA. The option is now enabled by default when --bwa/--maq is used.
  • Lots of unit tests added. Run them with cd tests && ./tests.sh.
  • Fix issue 16: --discard-trimmed did not work.
  • Allow to override auto-detection of input file format with the new -f/--format parameter. This mostly fixes issue 12.
  • Don’t break when input file is empty.

v0.9.2 (2011-03-16)

  • Install a single cutadapt Python package instead of multiple Python modules. This avoids cluttering the global namespace and should lead to less problems with other Python modules. Thanks to Steve Lianoglou for pointing this out to me!
  • ignore case (ACGT vs acgt) when comparing the adapter with the read sequence
  • .FASTA/.QUAL files (not necessarily colorspace) can now be read (some 454 software uses this format)
  • Move some functions into their own modules
  • lots of refactoring: replace the fasta module with a much nicer seqio module.
  • allow to input FASTA/FASTQ on standard input (also FASTA/FASTQ is autodetected)

v0.9 (2011-01-10)

  • add --too-short-output and --untrimmed-output, based on patch by Paul Ryvkin (thanks!)
  • add --maximum-length parameter: discard reads longer than a specified length
  • group options by category in --help output
  • add --length-tag option. allows to fix read length in FASTA/Q comment lines (e.g., length=123 becomes length=58 after trimming) (requested by Paul Ryvkin)
  • add -q/--quality-cutoff option for trimming low-quality ends (uses the same algorithm as BWA)
  • some refactoring
  • the filename - is now interpreted as standard in or standard output

v0.8 (2010-12-08)

  • Change default behavior of searching for an adapter: The adapter is now assumed to be an adapter that has been ligated to the 3’ end. This should be the correct behavior for at least the SOLiD small RNA protocol (SREK) and also for the Illumina protocol. To get the old behavior, which uses a heuristic to determine whether the adapter was ligated to the 5’ or 3’ end and then trimmed the read accordingly, use the new -b (--anywhere) option.
  • Clear up how the statistics after processing all reads are printed.
  • Fix incorrect statistics. Adapters starting at pos. 0 were correctly trimmed, but not counted.
  • Modify scoring scheme: Improves trimming (some reads that should have been trimmed were not). Increases no. of trimmed reads in one of our SOLiD data sets from 36.5 to 37.6%.
  • Speed improvements (20% less runtime on my test data set).

v0.7 (2010-12-03)

  • Useful exit codes
  • Better error reporting when malformed files are encountered
  • Add --minimum-length parameter for discarding reads that are shorter than a specified length after trimming.
  • Generalize the alignment function a bit. This is preparation for supporting adapters that are specific to either the 5’ or 3’ end.
  • pure Python fallback for alignment function for when the C module cannot be used.

v0.6 (2010-11-18)

  • Support gzipped input and output.
  • Print timing information in statistics.

v0.5 (2010-11-17)

  • add --discard option which makes cutadapt discard reads in which an adapter occurs

v0.4 (2010-11-17)

  • (more) correctly deal with multiple adapters: If a long adapter matches with lots of errors, then this could lead to a a shorter adapter matching with few errors getting ignored.

v0.3 (2010-09-27)

  • fix huge memory usage (entire input file was unintentionally read into memory)

v0.2 (2010-09-14)

  • allow FASTQ input

v0.1 (2010-09-14)

  • initial release